Informatie

Is er een aantoonbare hoeveelheid bacterieel DNA in het bloed van geïnfecteerde personen?

Is er een aantoonbare hoeveelheid bacterieel DNA in het bloed van geïnfecteerde personen?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Met welke bacteriële infectie bij de mens is aangetoond dat bacterieel DNA in het bloed te vinden is?

Als er een wordt gevonden, is het waarschijnlijk niet erg veel, en zelfs moeilijk te onderscheiden van menselijk DNA, maar vermoedelijk zou recente vooruitgang in sequencing het mogelijk moeten hebben gemaakt.


Alles hangt af van de infectie en van de algemene immuunstatus van de patiënt.

Over het algemeen is de voorwaarde voor vrije circulatie van DNA in het bloed de aanwezigheid van bacteriën zelf in het bloed (bacteriëmie). Dit betekent dat de infectie zijn oorspronkelijke plaats heeft verlaten (waar het gewoonlijk door het immuunsysteem geïsoleerd wordt gehouden van de bloedstroom). Afhankelijk van de lichaamsreactie op deze doorbraak kunnen sepsis en/of SIRS de gevolgen zijn.

Onder deze omstandigheden (niet noodzakelijk zo ernstig als sepsis, maar in het geval van bewezen bacteriëmie), worden de bacteriecellen aangevallen door de immuuncellen, wat leidt tot hun uiteindelijke lysering en het vrijgeven van hun inhoud aan het bloed.

PCR kan worden gebruikt als een methode om het bestaan ​​van bacterieel DNA te bewijzen. (Hier is een openbaar beschikbaar artikel over dit onderwerp).


Is er een aantoonbare hoeveelheid bacterieel DNA in het bloed van geïnfecteerde personen? - Biologie

Figuur 1. Friedrich Miescher (1844-1895) ontdekte nucleïnezuren.

Ons huidige begrip van DNA begon met de ontdekking van nucleïnezuren, gevolgd door de ontwikkeling van het dubbele-helixmodel. In de jaren 1860 isoleerde Friedrich Miescher (Figuur 1), een arts van beroep, fosfaatrijke chemicaliën uit witte bloedcellen (leukocyten). Hij noemde deze chemicaliën (die uiteindelijk bekend zouden worden als DNA) nucleïne omdat ze geïsoleerd waren uit de kernen van de cellen.

Om Miescher stap voor stap een experiment te zien uitvoeren, klikt u door dit overzicht van hoe hij de sleutelrol van DNA en eiwitten in de kern ontdekte.

Een halve eeuw later, in 1928, rapporteerde de Britse bacterioloog Frederick Griffith de eerste demonstratie van bacteriële transformatie — een proces waarbij extern DNA door een cel wordt opgenomen, waardoor de morfologie en fysiologie verandert. Griffith voerde zijn experimenten uit met Streptococcus pneumoniae, een bacterie die longontsteking veroorzaakt. Griffith werkte met twee stammen van deze bacterie, ruw (R) en glad (S). (De twee celtypen werden "ruw" en "glad" genoemd naar het verschijnen van hun kolonies die op een voedingsagarplaat waren gegroeid.)

De R-stam is niet-pathogeen (veroorzaakt geen ziekte). De S-stam is pathogeen (ziekteverwekkend) en heeft een capsule buiten de celwand. Door de capsule kan de cel ontsnappen aan de immuunreacties van de gastheermuis.

Toen Griffith de levende S-stam in muizen injecteerde, stierven ze aan een longontsteking. Toen Griffith daarentegen de levende R-stam in muizen injecteerde, overleefden ze. In een ander experiment, toen hij muizen injecteerde met de door hitte gedode S-stam, overleefden ze ook. Dit experiment toonde aan dat de capsule alleen niet de doodsoorzaak was. In een derde reeks experimenten werd een mengsel van levende R-stam en door hitte gedode S-stam in muizen geïnjecteerd, en tot zijn verbazing stierven de muizen. Na het isoleren van de levende bacteriën van de dode muis, werd alleen de S-bacteriestam teruggevonden. Toen deze geïsoleerde S-stam in verse muizen werd geïnjecteerd, stierven de muizen. Griffith concludeerde dat er iets was overgegaan van de door hitte gedode S-stam in de levende R-stam en veranderde het in de pathogene S-stam. Hij noemde dit de transformerend principe: (Figuur 2). Deze experimenten staan ​​nu bekend als de transformatie-experimenten van Griffith.

Figuur 2. Twee stammen van S. pneumoniae werden gebruikt in de transformatie-experimenten van Griffith. De R-stam is niet-pathogeen. De S-stam is pathogeen en veroorzaakt de dood. Toen Griffith een muis injecteerde met de door hitte gedode S-stam en een levende R-stam, stierf de muis. De S-stam werd gewonnen uit de dode muis. Griffith concludeerde dus dat er iets was overgegaan van de door hitte gedode S-stam naar de R-stam, waardoor de R-stam in het proces werd getransformeerd in S-stam. (credit '8220living mouse'8221: wijziging van werk door NIH credit '8220dead mouse'8221: wijziging van werk door Sarah Marriage)

Wetenschappers Oswald Avery, Colin MacLeod en Maclyn McCarty (1944) waren geïnteresseerd in het verder onderzoeken van dit transformerende principe. Ze isoleerden de S-stam uit de dode muizen en isoleerden de eiwitten en nucleïnezuren (RNA en DNA) omdat deze mogelijke kandidaten waren voor het erfelijke molecuul. Ze gebruikten enzymen die elke component specifiek afbraken en gebruikten vervolgens elk mengsel afzonderlijk om de R-stam te transformeren. Ze ontdekten dat wanneer DNA werd afgebroken, het resulterende mengsel de bacteriën niet langer kon transformeren, terwijl alle andere combinaties de bacteriën konden transformeren. Dit bracht hen tot de conclusie dat DNA het transformerende principe was.

Forensische wetenschappers en DNA-analyse

Forensische wetenschappers gebruikten voor het eerst DNA-analysebewijs om een ​​immigratiezaak op te lossen. Het verhaal begon met een tiener die vanuit Ghana terugkeerde naar Londen om bij zijn moeder te zijn. De immigratiediensten op de luchthaven stonden wantrouwend tegenover hem, omdat ze dachten dat hij op een vervalst paspoort reisde. Na veel overreding mocht hij bij zijn moeder gaan wonen, maar de immigratiedienst liet de zaak tegen hem niet vallen. Alle soorten bewijsmateriaal, inclusief foto's, werden aan de autoriteiten verstrekt, maar desalniettemin werden de uitzettingsprocedures gestart. Rond dezelfde tijd had Dr. Alec Jeffreys van de Leicester University in het Verenigd Koninkrijk een techniek uitgevonden die bekend staat als DNA-fingerprinting. De immigratie-autoriteiten benaderden Dr. Jeffreys voor hulp. Hij nam DNA-monsters van de moeder en drie van haar kinderen, evenals een niet-verwante moeder, en vergeleek de monsters met het DNA van de jongen. Omdat de biologische vader niet op de foto stond, is het DNA van de drie kinderen vergeleken met het DNA van de jongen. Hij vond een match in het DNA van de jongen voor zowel de moeder als zijn drie broers en zussen. Hij concludeerde dat de jongen inderdaad de zoon van de moeder was.

Forensische wetenschappers analyseren veel items, waaronder documenten, handschrift, vuurwapens en biologische monsters. Ze analyseren het DNA-gehalte van haar, sperma, speeksel en bloed en vergelijken dit met een database met DNA-profielen van bekende criminelen. Analyse omvat DNA-isolatie, sequentiebepaling en sequentieanalyse. Forensische wetenschappers zullen naar verwachting verschijnen op rechtszittingen om hun bevindingen te presenteren. Ze worden meestal gebruikt in misdaadlaboratoria van stads- en staatsoverheidsinstanties. Genetici die experimenteren met DNA-technieken werken ook voor wetenschappelijke en onderzoeksorganisaties, de farmaceutische industrie en laboratoria van hogescholen en universiteiten. Studenten die een carrière als forensisch wetenschapper willen nastreven, moeten minimaal een bachelordiploma in scheikunde, biologie of natuurkunde hebben en bij voorkeur enige ervaring in een laboratorium.

Hoewel de experimenten van Avery, McCarty en McLeod hadden aangetoond dat DNA de informatieve component was die tijdens transformatie werd overgedragen, werd DNA nog steeds beschouwd als een te eenvoudig molecuul om biologische informatie te dragen. Eiwitten, met hun 20 verschillende aminozuren, werden als meer waarschijnlijke kandidaten beschouwd. Het beslissende experiment, uitgevoerd door Martha Chase en Alfred Hershey in 1952, leverde bevestigend bewijs dat DNA inderdaad het genetische materiaal was en geen eiwitten. Chase en Hershey bestudeerden een bacteriofaag — een virus dat bacteriën infecteert. Virussen hebben meestal een eenvoudige structuur: een eiwitmantel, de capside genaamd, en een nucleïnezuurkern die het genetische materiaal bevat (DNA of RNA). De bacteriofaag infecteert de bacteriële gastheercel door zich aan het oppervlak te hechten en injecteert vervolgens zijn nucleïnezuren in de cel. Het faag-DNA maakt meerdere kopieën van zichzelf met behulp van de gastheermachinerie, en uiteindelijk barst de gastheercel, waardoor een groot aantal bacteriofagen vrijkomt. Hershey en Chase selecteerden radioactieve elementen die het eiwit specifiek zouden onderscheiden van het DNA in geïnfecteerde cellen. Ze labelden een batch faag met radioactieve zwavel, 35S, om de eiwitmantel te labelen. Een andere batch fagen werd gelabeld met radioactief fosfor, 32 P. Omdat fosfor in DNA wordt aangetroffen, maar niet in eiwit, zou het DNA en niet het eiwit worden gelabeld met radioactief fosfor. Evenzo is zwavel afwezig in DNA, maar aanwezig in verschillende aminozuren zoals methionine en cysteïne.

Elke batch faag mocht de cellen afzonderlijk infecteren. Na infectie werd de faagbacteriële suspensie in een blender gedaan, waardoor de faagmantel loskwam van de gastheercel. Cellen die lang genoeg waren blootgesteld om infectie te laten optreden, werden vervolgens onderzocht om te zien welke van de twee radioactieve moleculen de cel was binnengekomen. De faag en bacteriële suspensie werden in een centrifuge afgedraaid. De zwaardere bacteriecellen bezonken en vormden een pellet, terwijl de lichtere faagdeeltjes in het supernatant bleven. In de buis die faag bevatte gelabeld met 35S, bevatte het supernatant de radioactief gelabelde faag, terwijl er geen radioactiviteit werd gedetecteerd in de pellet. In de buis die de faag bevatte die was gelabeld met 32P, werd de radioactiviteit gedetecteerd in de pellet die de zwaardere bacteriële cellen bevatte, en er werd geen radioactiviteit gedetecteerd in het supernatant. Hershey en Chase concludeerden dat het het faag-DNA was dat in de cel werd geïnjecteerd en informatie droeg om meer faagdeeltjes te produceren, waarmee ze het bewijs leverden dat DNA het genetische materiaal was en geen eiwitten (Figuur 3).

Figuur 3. In de experimenten van Hershey en Chase werden bacteriën geïnfecteerd met fagen die radioactief waren gelabeld met ofwel 35S, dat eiwit labelt, of 32P, dat DNA labelt. Alleen 32P kwam de bacteriële cellen binnen, wat aangeeft dat DNA het genetische materiaal is.

Rond dezelfde tijd onderzocht de Oostenrijkse biochemicus Erwin Chargaff het DNA-gehalte in verschillende soorten en ontdekte dat de hoeveelheden adenine, thymine, guanine en cytosine niet in gelijke hoeveelheden werden gevonden, en dat de relatieve concentraties van de vier nucleotidebasen per soort verschilden. aan soorten, maar niet binnen weefsels van hetzelfde individu of tussen individuen van dezelfde soort. Hij ontdekte ook iets onverwachts: dat de hoeveelheid adenine gelijk was aan de hoeveelheid thymine, en de hoeveelheid cytosine gelijk aan de hoeveelheid guanine (dat wil zeggen, A = T en G = C). Verschillende soorten hadden gelijke hoeveelheden purines (A+G) en pyrimidines (T + C), maar verschillende verhoudingen van A+T tot G+C. Deze waarnemingen werden bekend als: De regels van Chargaff . De bevindingen van Chargaff bleken enorm nuttig toen Watson en Crick zich klaarmaakten om hun DNA-dubbele helixmodel voor te stellen! U kunt na het lezen van de afgelopen pagina's zien hoe de wetenschap voortbouwt op eerdere ontdekkingen, soms in een langzaam en moeizaam proces.

Oefenvraag

De experimenten van Hershey en Chase hielpen te bevestigen dat DNA het erfelijke materiaal was op basis van de bevinding dat:

  1. radioactieve fagen werden gevonden in de pellet
  2. radioactieve cellen werden gevonden in het supernatant
  3. radioactieve zwavel werd gevonden in de cel
  4. radioactief fosfor werd gevonden in de cel

Samengevat: De geschiedenis van DNA

DNA werd voor het eerst geïsoleerd uit witte bloedcellen door Friedrich Miescher, die het nucleïne noemde omdat het uit kernen was geïsoleerd. Frederick Griffith's experimenten met stammen van Streptococcus pneumoniae gaf de eerste hint dat DNA het transformerende principe zou kunnen zijn. Avery, MacLeod en McCarty bewezen dat DNA nodig is voor de transformatie van bacteriën. Latere experimenten van Hershey en Chase met bacteriofaag T2 bewezen dat DNA het genetische materiaal is. Chargaff ontdekte dat de verhouding van A = T en C = G, en dat het percentage van A, T, G en C verschillend is voor verschillende soorten.


Relatie tussen humaan herpesvirus 8 perifere bloedvirusbelasting en het klinische stadium van Kaposi-sarcoom

Doelstelling: Om de relatie te bepalen tussen humaan herpesvirus 8 (HHV-8 of Kaposi's sarcoom-geassocieerd herpesvirus) perifere bloedvirusbelasting en Kaposi's sarcoom (KS) klinische fase.

Ontwerp: Geblindeerde, transversale analyse van HHV-8 DNA-niveaus in perifeer bloed bij personen met aids-gerelateerde KS in Harare, Zimbabwe.

Methoden: De proefpersonen werden gestratificeerd op KS-klinisch stadium. De hoeveelheid HHV-8-DNA in plasma en mononucleaire cellen van perifeer bloed (PBMC) werd bepaald door kwantitatieve real-time PCR-amplificatie van het open leesraam 26 van HHV-8.

Resultaten: Eenendertig met HIV-1/HHV-8 geïnfecteerde personen werden onderzocht: 26 proefpersonen hadden histologisch bevestigde KS (één stadium II, 11 stadium III en 14 stadium IV) en vijf proefpersonen hadden antilichamen tegen HHV-8 maar hadden geen KS. De leeftijd, het aantal CD4-lymfocyten en de plasma-hiv-1-RNA-spiegels waren vergelijkbaar in alle groepen. HHV-8-DNA werd gedetecteerd in het plasma van alle met HHV-8 geïnfecteerde proefpersonen (bereik <. 2,4 tot 5,2 log10 kopieën/ml), maar plasma-HHV-8-DNA-spiegels waren niet geassocieerd met KS-ziektestadium. Daarentegen was de hoeveelheid HHV-8-DNA in PBMC (bereik <. 0,7 tot 4,5 log10 kopieën/microg) sterk geassocieerd met het klinische stadium van KS (P = 0,005). Onder stadium IV KS-gevallen was er een lineair verband tussen plasma- en PBMC HHV-8-DNA-niveaus (r2 = 0,42 P = 0,01).

Conclusie: De sterke associatie die werd waargenomen tussen de omvang van de KS-ziekte en de niveaus van HHV-8-DNA in PBMC levert verder bewijs voor een verband tussen de HHV-8-virusbelasting en de pathogenese van KS.


Is er een aantoonbare hoeveelheid bacterieel DNA in het bloed van geïnfecteerde personen? - Biologie

Aangezien moleculaire technieken voor het identificeren en detecteren van micro-organismen in het klinisch microbiologisch laboratorium routine zijn geworden, moeten vragen over de kosten van deze technieken en hun bijdrage aan de patiëntenzorg worden beantwoord. Moleculaire diagnose is het meest geschikt voor infectieuze agentia die moeilijk tijdig kunnen worden opgespoord, geïdentificeerd of getest met conventionele methoden.

De instrumenten van de moleculaire biologie zijn gemakkelijk aan te passen voor gebruik in het klinisch diagnostisch laboratorium en beloven uiterst nuttig te zijn bij diagnose, therapie en epidemiologisch onderzoek en infectiebeheersing (1,2). Hoewel technische problemen zoals prestatiegemak, reproduceerbaarheid, gevoeligheid en specificiteit van moleculaire tests belangrijk zijn, zijn de kosten en de mogelijke bijdrage aan de patiëntenzorg ook een punt van zorg (3). Moleculaire methoden kunnen in veel opzichten een verbetering zijn ten opzichte van conventionele microbiologische tests. Momenteel is hun meest praktische en nuttige toepassing bij het detecteren en identificeren van infectieuze agentia waarvoor routinematige kweek- en microscopiemethoden op basis van groei mogelijk niet voldoende zijn (47).

Op nucleïnezuur gebaseerde tests die worden gebruikt bij het diagnosticeren van infectieziekten maken gebruik van standaardmethoden voor het isoleren van nucleïnezuren uit organismen en klinisch materiaal en restrictie-endonuclease-enzymen, gelelektroforese en nucleïnezuurhybridisatietechnieken om DNA of RNA te analyseren (6). Omdat het doelwit-DNA of -RNA in zeer kleine hoeveelheden aanwezig kan zijn in klinische monsters, zijn er verschillende technieken voor signaalamplificatie en doelwitamplificatie gebruikt om infectieuze agentia op te sporen in klinische diagnostische laboratoria (5,6). Hoewel het voornamelijk een onderzoeksinstrument is, is nucleïnezuursequentieanalyse in combinatie met doelamplificatie klinisch nuttig en helpt het bij het detecteren en identificeren van voorheen oncultiveerbare organismen en het karakteriseren van genmutaties van antimicrobiële resistentie, waardoor zowel de diagnose als de behandeling van infectieziekten wordt bevorderd (5,8,9). Automatisering en high-density oligonucleotide probe arrays (DNA-chips) zijn ook veelbelovend voor het karakteriseren van microbiële pathogenen (6).

Hoewel de meeste clinici en microbiologen de nieuwe moleculaire tests voor het diagnosticeren van infectieziekten enthousiast verwelkomen, zijn de hoge kosten van deze tests zorgwekkend (3). Ondanks de waarschijnlijkheid dat een beter resultaat voor de patiënt en lagere kosten van antimicrobiële middelen en een langere opnameduur in het ziekenhuis opwegen tegen de hogere laboratoriumkosten die ontstaan ​​door het gebruik van moleculaire testen, zijn dergelijke besparingen moeilijk te documenteren (3,10,11). Een groot deel van de rechtvaardiging voor uitgaven aan moleculaire testen is speculatief (11) de kosten van apparatuur, reagentia en opgeleid personeel zijn echter reëel en aanzienlijk, en terugbetalingsproblemen zijn problematisch (3,11). Gezien deze zorgen, moet de behoefte van een instelling aan moleculair diagnostisch testen voor infectieziekten kritisch worden onderzocht door de betrokken klinische en laboratoriumdiensten. In veel gevallen kunnen zorgvuldig toezicht op de bestelling van tests en verstandig gebruik van een referentielaboratorium de meest haalbare opties zijn.

Praktische toepassingen van moleculaire methoden in het laboratorium voor klinische microbiologie

Commerciële kits voor de moleculaire detectie en identificatie van infectieuze pathogenen hebben gezorgd voor een mate van standaardisatie en gebruiksgemak die de introductie van moleculaire diagnostiek in het laboratorium voor klinische microbiologie hebben vergemakkelijkt (tabel 1). Het gebruik van nucleïnezuurprobes voor het identificeren van gekweekte organismen en voor directe detectie van organismen in klinisch materiaal was de eerste blootstelling die de meeste laboratoria hadden aan commercieel beschikbare moleculaire tests. Hoewel deze sondetests nog steeds veel worden gebruikt, worden in toenemende mate op amplificatie gebaseerde methoden gebruikt voor de diagnose, identificatie en kwantificering van pathogenen en karakterisering van genen voor resistentie tegen antibiotica. Commerciële amplificatiekits zijn beschikbaar voor sommige pathogenen (Tabel 1), maar sommige klinisch belangrijke pathogenen vereisen door de onderzoeker ontworpen of "zelfgemaakte" methoden (Tabel 2). Bovendien is moleculaire stamtypering, of genotypering, nuttig gebleken bij het begeleiden van therapeutische beslissingen voor bepaalde virale pathogenen en voor epidemiologisch onderzoek en infectiebeheersing (2,12).

Detectie en identificatie van pathogenen zonder doelamplificatie

Commerciële kits met niet-isotopisch gelabelde nucleïnezuurprobes zijn beschikbaar voor directe detectie van pathogenen in klinisch materiaal en identificatie van organismen na isolatie in kweek (tabel 1). Het gebruik van hybridisatie in de oplossingsfase heeft het mogelijk gemaakt om tests afzonderlijk of in batches in een bekend microwell-formaat uit te voeren.

Hoewel directe detectie van organismen in klinische monsters door nucleïnezuurprobes snel en eenvoudig is, lijdt het aan een gebrek aan gevoeligheid. De meeste directe sondedetectieassays vereisen ten minste 104 kopieën van nucleïnezuur per microliter voor betrouwbare detectie, een vereiste waaraan zelden wordt voldaan in klinische monsters zonder enige vorm van amplificatie. Amplificatie van het detectiesignaal na probehybridisatie verbetert de gevoeligheid tot slechts 500 genkopieën per microliter en verschaft kwantitatieve mogelijkheden.Deze benadering is uitgebreid gebruikt voor kwantitatieve tests van virale belasting (HIV, hepatitis B-virus [HBV] en hepatitis C-virus [HCV]) (Tabel 1), maar komt niet overeen met de analytische gevoeligheid van op doelamplificatie gebaseerde methoden, zoals polymerase kettingreactie (PCR), voor het detecteren van organismen.

De commerciële sondesystemen die hybridisatie in de oplossingsfase en chemiluminescentie gebruiken voor directe detectie van infectieuze agentia in klinisch materiaal, omvatten de PACE2-producten van Gen-Probe en de hybride capture-assaysystemen van Digene en Murex (Tabel 1). Deze systemen zijn gebruiksvriendelijk, hebben een lange houdbaarheid en zijn aanpasbaar aan kleine of grote aantallen exemplaren. De PACE2-producten zijn ontworpen voor directe detectie van zowel Neisseria gonorrhoeae als Chlamydia trachomatis in een enkel monster (één monster, twee afzonderlijke sondes). De hybride opvangsystemen detecteren humaan papillomavirus (HPV) in baarmoederhalsafkrabsels, herpes-simplexvirus (HSV) in blaasjesmateriaal en cytomegalovirus (CMV) in bloed en andere vloeistoffen. Al deze tests hebben een gevoeligheid aangetoond die groter is dan die van kweek- of immunologische methoden voor het detecteren van de respectieve pathogenen, maar zijn minder gevoelig dan PCR of andere op doelamplificatie gebaseerde methoden.

De op signaalamplificatie gebaseerde probe-methoden voor detectie en kwantificering van virussen (HBV, HCV, HIV) worden gepresenteerd in een enzym-immunoassay-achtig formaat en omvatten vertakte keten DNA-probes (Chiron) en QB-replicase (Gene-Trak) methoden (tabel 1 ). Deze methoden zijn niet zo gevoelig als op target-amplificatie gebaseerde methoden voor de detectie van virussen, maar de kwantitatieve resultaten zijn nuttig gebleken voor het bepalen van de virale lading en prognose en voor het bewaken van de respons op therapie (13).

Sondehybridisatie is nuttig voor het identificeren van langzaam groeiende organismen na isolatie in kweek met behulp van vloeibare of vaste media. Identificatie van mycobacteriën en andere langzaam groeiende organismen zoals de dimorfe schimmels (Histoplasma capsulatum, Coccidioides immitis en Blastomyces dermatitidis) is zeker vergemakkelijkt door in de handel verkrijgbare sondes. Alle commerciële sondes voor het identificeren van organismen worden geproduceerd door Gen-Probe en gebruiken met acridiniumester gemerkte sondes gericht op soortspecifieke rRNA-sequenties (Tabel 1). Gen-Probe-producten zijn beschikbaar voor de kweekidentificatie van Mycobacterium tuberculosis, M. avium-intracellulare-complex, M. gordonae, M. kansasii, Cryptococcus neoformans, de dimorfe schimmels (hierboven vermeld), N. gonorrhoeae, Staphylococcus aureus, Streptococcus pneumoniae, Escherichia coli, Haemophilus influenzae, Enterococcus spp., S. agalactiae en Listeria monocytogenes. De gevoeligheid en specificiteit van deze sondes zijn uitstekend en ze zorgen voor soortidentificatie binnen één werkdag. Omdat de meeste van de vermelde bacteriën, plus C. neoformans, gemakkelijk en efficiënt kunnen worden geïdentificeerd met conventionele methoden binnen 1 tot 2 dagen, zijn veel van deze sondes niet op grote schaal gebruikt. De mycobacteriële sondes daarentegen worden aanvaard als steunpilaren voor de identificatie van M. tuberculosis en verwante soorten (7).

Nucleïnezuuramplificatie

Nucleïnezuuramplificatie biedt het vermogen om specifieke doelwitten die in lage concentraties aanwezig zijn selectief te amplificeren tot detecteerbare niveaus, dus op amplificatie gebaseerde methoden bieden superieure prestaties, in termen van gevoeligheid, ten opzichte van de directe (niet-geamplificeerde) op sonde gebaseerde tests. PCR (Roche Molecular Systems, Branchburg, NJ) was de eerste dergelijke techniek die werd ontwikkeld en vanwege zijn flexibiliteit en gemakkelijke prestaties blijft het de meest gebruikte moleculaire diagnostische techniek in zowel onderzoeks- als klinische laboratoria. Er zijn verschillende op amplificatie gebaseerde strategieën ontwikkeld en deze zijn in de handel verkrijgbaar (tabel 1). Commerciële op amplificatie gebaseerde moleculaire diagnostische systemen voor infectieziekten hebben zich grotendeels gericht op systemen voor het detecteren van N. gonorrhoeae, C. trachomatis, M. tuberculosis en specifieke virale infecties (HBV, HCV, HIV, CMV en enterovirus) (Tabel 1). Gezien het aanpassingsvermogen van PCR zijn er talrijke aanvullende infectieuze pathogenen gedetecteerd door door onderzoekers ontwikkelde of zelfgebouwde PCR-assays (5) (Tafel 2). In veel gevallen leveren dergelijke tests belangrijke en klinisch relevante informatie op die anders niet beschikbaar zou zijn, aangezien commerciële belangen traag zijn geweest om de productlijn die beschikbaar is voor klinische laboratoria uit te breiden. Naast kwalitatieve detectie van virussen, wordt nu erkend dat de kwantificering van de virale lading in klinische monsters van groot belang is voor de diagnose, prognose en therapeutische monitoring van HCV, HIV, HBV en CMV (13). Zowel op PCR- als op nucleïnezuurstrengen gebaseerde amplificatiesystemen zijn beschikbaar voor kwantificering van een of meer virussen (Tabel 1).

De aanpassing van op amplificatie gebaseerde testmethoden aan in de handel verkrijgbare kits heeft gediend om de acceptatie door de gebruiker te optimaliseren, contaminatie te voorkomen, reagentia en testomstandigheden te standaardiseren en automatisering mogelijk te maken. Het is niet duidelijk in hoeverre de detectieniveaus die door de verschillende amplificatiestrategieën kunnen worden bereikt, verschillen. Geen van de nieuwere methoden biedt een gevoeligheidsniveau dat hoger is dan dat van PCR. Bij het kiezen van een moleculair diagnostisch systeem moet men rekening houden met de reeks beschikbare tests, de geschiktheid van de methode voor de workflow en de kosten (6). Het is zeker praktisch om één op amplificatie gebaseerde methode te kiezen die testmogelijkheden biedt voor verschillende pathogenen.

Op amplificatie gebaseerde methoden zijn ook waardevol voor het identificeren van gekweekte en niet-kweekbare organismen (5). Amplificatiereacties kunnen worden ontworpen om een ​​zuurvast organisme snel te identificeren als M. tuberculosis of kunnen een geslachtsspecifiek of "universeel" doelwit amplificeren, dat vervolgens wordt gekarakteriseerd door het gebruik van restrictie-endonucleasedigestie, hybridisatie met meerdere probes of sequentiebepaling om te voorzien in afbakening van soorten of zelfs ondersoorten (4,5,14). Hoewel identificatie aanvankelijk werd toegepast op langzaam groeiende mycobacteriën, heeft het toepassingen voor andere pathogenen die moeilijk of onmogelijk te identificeren zijn met conventionele methoden.

Antimicrobiële resistentie detecteren

Moleculaire methoden kunnen resistentie tegen antimicrobiële geneesmiddelen snel detecteren in klinische omgevingen en hebben aanzienlijk bijgedragen aan ons begrip van de verspreiding en genetica van resistentie (9). Conventionele op bouillon en agar gebaseerde antimicrobiële gevoeligheidstestmethoden bieden een fenotypisch profiel van de respons van een bepaalde microbe op een reeks middelen. Hoewel ze bruikbaar zijn voor het selecteren van potentieel bruikbare therapeutische middelen, zijn conventionele werkwijzen traag en beladen met problemen. De meest voorkomende tekortkoming is de detectie van methicillineresistentie in stafylokokken, die zich op een zeer heterogene manier kan uiten, waardoor fenotypische karakterisering van resistentie moeilijk wordt (9,15). Momenteel is moleculaire detectie van het resistentiegen, mec A, de standaard waartegen fenotypische methoden voor detectie van methicillineresistentie worden beoordeeld (9,15,16).

Moleculaire methoden kunnen worden gebruikt om specifieke genen voor antimicrobiële resistentie tegen geneesmiddelen (resistentiegenotypering) in veel organismen te detecteren (tabel 3) (8,9). Detectie van specifieke puntmutaties geassocieerd met resistentie tegen antivirale middelen wordt ook steeds belangrijker (17,18). Screening op mutaties in een geamplificeerd product kan worden vergemakkelijkt door het gebruik van probe-arrays met hoge dichtheid (Gene-chips) (6).

Ondanks de vele potentiële voordelen, zal genotypering in de nabije toekomst waarschijnlijk niet de fenotypische methoden voor het detecteren van resistentie tegen antimicrobiële geneesmiddelen in het klinische laboratorium vervangen. Moleculaire methoden voor resistentiedetectie kunnen direct op het klinische monster worden toegepast, waardoor gelijktijdige detectie en identificatie van het pathogeen plus resistentiekarakterisering mogelijk is (9). Evenzo zijn ze nuttig bij het detecteren van resistentie bij virussen, langzaam groeiende of niet-levensvatbare organismen, of organismen met resistentiemechanismen die niet betrouwbaar worden gedetecteerd door fenotypische methoden (9,19). Vanwege hun hoge specificiteit zullen moleculaire methoden echter geen nieuw opkomende resistentiemechanismen detecteren en het is onwaarschijnlijk dat ze nuttig zijn bij het detecteren van resistentiegenen bij soorten waar het gen niet eerder is waargenomen (19). Verder betekent de aanwezigheid van een resistentiegen niet dat het gen tot expressie zal komen, en de afwezigheid van een bekend resistentiegen sluit de mogelijkheid van resistentie door een ander mechanisme niet uit. Met fenotypische testmethoden voor antimicrobiële gevoeligheid kunnen laboratoria veel organismen testen en zowel nieuw opkomende als gevestigde resistentiepatronen detecteren.

Moleculaire Epidemiologie

Figuur. Pulsed-field gelelektroforese (PFGE) profielen van Staphylococcus aureus isolaten gedigereerd met Sma 1. Een verscheidenheid aan PFGE-profielen wordt gedemonstreerd in deze 23 isolaten.

Laboratoriumkarakterisering van microbiële pathogenen als biologisch of genetisch verwant is vaak nuttig bij onderzoeken (12,20,21). Er zijn verschillende epidemiologische typeringsmethoden toegepast in onderzoeken naar microbiële pathogenen (tabel 4). De fenotypische methoden zijn af en toe nuttig geweest bij het beschrijven van de epidemiologie van infectieziekten, maar ze zijn te variabel, traag en arbeidsintensief om van veel nut te zijn bij de meeste epidemiologische onderzoeken. Nieuwere op DNA gebaseerde typeringsmethoden hebben de meeste van deze beperkingen geëlimineerd en zijn nu de voorkeurstechnieken voor epidemiologische typering. De meest gebruikte moleculaire typeringsmethoden omvatten plasmideprofilering, restrictie-endonuclease-analyse van plasmide en genomisch DNA, Southern-hybridisatieanalyse met behulp van specifieke DNA-probes en chromosomale DNA-profilering met behulp van pulsed-field gelelektroforese (PFGE) of op PCR gebaseerde methoden (12,20). Al deze methoden gebruiken elektrische velden om DNA-fragmenten, hele chromosomen of plasmiden te scheiden in unieke patronen of vingerafdrukken die worden gevisualiseerd door kleuring met ethidiumbromide of door hybridisatie van nucleïnezuurprobes (Figuur). Moleculaire typering wordt uitgevoerd om te bepalen of verschillende isolaten dezelfde of verschillende resultaten geven voor een of meer tests. Epidemiologisch verwante isolaten delen hetzelfde DNA-profiel of dezelfde vingerafdruk, terwijl sporadische of epidemiologisch niet-verwante isolaten duidelijk verschillende patronen hebben (Figuur). Als isolaten van verschillende patiënten dezelfde vingerafdruk delen, zijn ze waarschijnlijk afkomstig van dezelfde kloon en zijn ze door een gemeenschappelijke bron of mechanisme van patiënt op patiënt overgedragen.

Met moleculaire typeringsmethoden hebben onderzoekers de relatie tussen koloniserende en infecterende isolaten bij individuele patiënten kunnen bestuderen, verontreinigende van infecterende stammen kunnen onderscheiden, nosocomiale overdracht bij gehospitaliseerde patiënten kunnen documenteren, herinfectie versus terugval bij patiënten die worden behandeld voor een infectie, en de verspreiding van antimicrobiële stoffen kunnen volgen. -geneesmiddelresistente stammen binnen en tussen ziekenhuizen in de loop van de tijd (12). De meeste beschikbare op DNA gebaseerde typeringsmethoden kunnen worden gebruikt bij het bestuderen van ziekenhuisinfecties wanneer ze worden toegepast in de context van een zorgvuldig epidemiologisch onderzoek (12,21). Daarentegen kan zelfs de krachtigste en meest geavanceerde typemethode, indien willekeurig gebruikt bij afwezigheid van degelijke epidemiologische gegevens, tegenstrijdige en verwarrende informatie opleveren.

Financiële overwegingen

Moleculair testen op infectieziekten omvat testen op de aanleg van de gastheer voor ziekte, screening op geïnfecteerde of gekoloniseerde personen, diagnose van klinisch belangrijke infecties en monitoring van het verloop van infectie of de verspreiding van een specifiek pathogeen in een bepaalde populatie. Vaak wordt aangenomen dat moleculair testen naast verbeterde patiëntenzorg ook grote financiële voordelen kan opleveren, omdat de tests het gebruik van minder gevoelige en specifieke tests, onnodige diagnostische procedures en therapieën en nosocomiale infecties verminderen (11). De inherente kosten van moleculaire testmethoden, in combinatie met variabele en ontoereikende vergoedingen door derdebetalers en managed care-organisaties, hebben de introductie van deze tests in het klinisch diagnostisch laboratorium echter beperkt.

Niet alle moleculaire diagnostische tests zijn extreem duur. De directe kosten variëren sterk, afhankelijk van de complexiteit en verfijning van de test. Goedkope moleculaire tests zijn over het algemeen gebaseerd op kits en gebruiken methoden die weinig instrumentatie of technologische ervaring vereisen. DNA-sondemethoden die C. trachomatis of N. gonorrhoeae detecteren, zijn voorbeelden van goedkope moleculaire tests. De meer complexe moleculaire tests, zoals resistentiegenotypering, hebben vaak hoge arbeidskosten omdat ze ervaren, goed opgeleide technologen nodig hebben. Hoewel de meer geavanceerde tests dure apparatuur (bijv. DNA-sequencer) en reagentia kunnen vereisen, beloven vooruitgang in automatisering en de productie van minder dure reagentia deze kosten en de tijd van de technicus te verminderen. Belangrijke obstakels voor het opzetten van een moleculair diagnostisch laboratorium die vaak pas laat in het proces worden overwogen, zijn vereiste licenties, bestaande en hangende patenten, testselectie en facturering en terugbetaling (22).

Vergoedingsproblemen zijn een grote bron van verwarring, frustratie en inconsistentie. Vergoeding door derde betalers wordt in de war gebracht door het ontbreken van goedkeuring door de Food and Drug Administration (FDA) en de huidige procedurele terminologie (CPT)-codes voor veel moleculaire tests. Over het algemeen zijn moleculaire tests voor infectieziekten gemakkelijker geaccepteerd voor terugbetaling, maar terugbetaling is vaak per geval en kan traag en omslachtig zijn. FDA-goedkeuring van een test vergroot de kans dat deze wordt vergoed, maar garandeert niet dat het vergoede bedrag gelijk zal zijn aan de kosten van het uitvoeren van de test.

Misschien meer dan andere laboratoriumtests, kunnen moleculaire tests negatief worden beïnvloed door 'fee-for-service' managed care-contracten en algemene kortingen op de vergoedingen voor laboratoriumtests. Dergelijke maatregelen leiden vaak tot een vergoeding die lager is dan de kosten van het afnemen van de test. Hoewel moleculaire tests kunnen worden beschouwd als een middel om het welzijn van de patiënt te bevorderen, zijn de financiële voordelen van het welzijn van de patiënt niet gemakkelijk op korte termijn te realiseren (11). Organisaties voor gezondheidsonderhoud (HMO's) en managed-care-organisaties lijken vaak in kortere tijdsbestekken te werken, en hun beheerders zijn mogelijk niet geïnteresseerd in de langetermijneffecten van diagnostische teststrategieën.

Moleculaire screeningsprogramma's voor infectieziekten worden ontwikkeld om symptomatische en asymptomatische ziekten bij individuen en groepen op te sporen. Personen met een hoog risico, zoals immuungecompromitteerde patiënten of patiënten die een kliniek voor gezinsplanning of verloskunde bezoeken, worden gescreend op respectievelijk CMV en Chlamydia. Evenzo worden alle bloeddonoren gescreend op door bloed overgedragen ziekteverwekkers. De financiële uitkomst van een dergelijke test is onbekend. De kosten moeten worden afgewogen tegen de voordelen van eerdere diagnose en behandeling en maatschappelijke kwesties zoals epidemiologie van ziekten en populatiebeheer.

Een van de meest aangeprezen voordelen van moleculair testen voor infectieziekten is de belofte van eerdere detectie van bepaalde pathogenen. De snelle detectie van M. tuberculosis rechtstreeks in klinische monsters door PCR of andere op amplificatie gebaseerde methoden is zeer waarschijnlijk kosteneffectief bij de behandeling van tuberculose (7). Andere voorbeelden van infectieziekten die vatbaar zijn voor moleculaire diagnose en waarvan de behandeling door deze technologie kan worden verbeterd, zijn onder meer HSV-encefalitis, Helicobacter pylori-infectie en neuroborreliose veroorzaakt door Borrelia burgdorferi. Voor HSV-encefalitis kan detectie van HSV in cerebrospinale vloeistof (CSF) specifieke therapie sturen en andere tests, waaronder hersenbiopsie, elimineren. Evenzo kan detectie van H. pylori in maagvloeistof de therapie sturen en de noodzaak van endoscopie en biopsie ondervangen. PCR-detectie van B. burgdorferi in CSF is nuttig bij het onderscheiden van neuroborreliose van andere chronische neurologische aandoeningen en chronisch vermoeidheidssyndroom.

Zoals eerder besproken, kunnen moleculaire tests worden gebruikt om de ziekterespons op specifieke antimicrobiële therapie te voorspellen. Detectie van specifieke resistentiegenen (mec A, van A) of puntmutaties die resulteren in resistentie, is effectief gebleken bij het beheersen van ziekten. Op moleculair niveau testen van de virale lading is de standaardpraktijk geworden voor patiënten met chronische hepatitis en aids. Virale belastingtests en genotypering van HCV zijn nuttig bij het bepalen van het gebruik van dure therapie zoals interferon en kunnen worden gebruikt om beslissingen over de omvang en duur van de therapie te rechtvaardigen. Bij AIDS zijn bepalingen van de virale belasting plus genotypering van resistentie gebruikt om een ​​keuze te maken uit de verschillende proteaseremmers die beschikbaar zijn voor behandeling, waardoor de respons van de patiënt wordt verbeterd en de incidentie van opportunistische infecties wordt verminderd.

Farmacogenomica is het gebruik van moleculaire tests om de respons op specifieke therapieën te voorspellen en de respons van de ziekte op de toegediende middelen te volgen. De beste voorbeelden van farmacogenomica bij infectieziekten zijn het gebruik van virale belasting en resistentiegenotypering om antivirale therapie van aids en chronische hepatitis te selecteren en te volgen (17,18). Deze applicatie verbetert de uitkomst van de ziekte, verkort de opnameduur, vermindert bijwerkingen en toxiciteit en maakt een kosteneffectieve therapie mogelijk door onnodige dure medicijnen te vermijden, doseringen en timing te optimaliseren en ineffectieve medicijnen te elimineren.

Typering van micro-organismen door moleculaire stammen wordt nu algemeen erkend als een essentieel onderdeel van een uitgebreid programma voor infectiebeheersing, waarbij ook de afdeling infectiebeheersing, de afdeling infectieziekten en de apotheek zijn betrokken (10,21). Moleculaire technieken voor het vaststellen van de aan- of afwezigheid van klonaliteit zijn effectief bij het volgen van de verspreiding van nosocomiale infecties en het stroomlijnen van de activiteiten van het infectiebeheersingsprogramma (21,23). Een uitgebreid infectiebeheersingsprogramma maakt gebruik van actieve surveillance door zowel infectiebeheersingsdeskundigen als het klinisch microbiologisch laboratorium om clusters van infecties met een gemeenschappelijk microbieel fenotype (dezelfde soort en antimicrobieel gevoeligheidsprofiel) te identificeren. De isolaten worden vervolgens in het laboratorium gekarakteriseerd met behulp van een van een aantal moleculaire typeringsmethoden (tabel 4) om klonaliteit te bevestigen of te weerleggen. Op basis van beschikbare epidemiologische en moleculaire gegevens ontwikkelt de ziekenhuisepidemioloog vervolgens een interventiestrategie. Moleculaire typering kan een epidemie inkorten of voorkomen (23) en het aantal en de kosten van ziekenhuisinfecties te verminderen (Tabel 5) (10). Haek et al. (10) analyseerde de medische en economische voordelen van een infectiebeheersingsprogramma dat routinematige bepaling van microbiële klonaliteit omvatte en ontdekte dat ziekenhuisinfecties significant waren afgenomen en meer dan $ 4 miljoen werd bespaard over een periode van 2 jaar (tabel 5).

De echte financiële impact van moleculair testen wordt alleen gerealiseerd wanneer testprocedures worden geïntegreerd in de totale ziektebeoordeling. Duurdere testprocedures kunnen gerechtvaardigd zijn als ze het gebruik van minder gevoelige en minder specifieke tests verminderen en onnodige diagnostische procedures en ineffectieve therapieën elimineren.

dr.Pfaller is professor en directeur van het Molecular Epidemiology and Fungus Testing Laboratory aan de University of Iowa College of Medicine en College of Public Health. Zijn onderzoek richt zich op de epidemiologie van ziekenhuisinfecties en resistentie tegen antibiotica.


Moleculaire basis van ziektediagnose en behandeling (met diagram)

Een ziekte, in moleculaire zin, kan worden gedefinieerd als elke afwijking in het levende systeem. De afwijking kan ontstaan ​​door infectie door virussen, bacteriën, schimmels, parasieten, eiwitten of kleine moleculen in/van mens, dier, plant, water en bodem. De afwijking kan ook ontstaan ​​door veranderingen in de moleculaire structuur in de cellen. Een verandering in de DNA-sequentie die bekend staat als mutatie kan bijvoorbeeld verschillende aandoeningen/ziekten veroorzaken.

De preventie en behandeling van deze ziekten is alleen mogelijk als de veroorzaker van de ziekte op het juiste moment kan worden gediagnosticeerd. Tot nu toe werden veel kostbare en arbeidsintensieve klinische procedures gebruikt bij de diagnose en behandeling van deze ziekten. Met de vooruitgang van de moleculaire biotechnologie worden nu verschillende moleculaire diagnostische methoden toegepast bij de diagnose en ook bij de behandeling van deze ziekten.

Moleculaire diagnose:

Een diagnostische test kan alleen effectief zijn als:

(a) Specifiek voor het doelmolecuul

(b) Gevoelig om zelfs minuscule niveaus van het doelwit te detecteren en

Er zijn twee klassen van moleculaire diagnostische technieken:

(1) DNA-detectiemethoden - die nucleïnezuurhybridisatie of de polymerasekettingreactie gebruiken om een ​​specifieke nucleïnezuursequentie te detecteren.

(2) Immunologische methoden - zijn gebaseerd op de specificiteit van een antilichaam voor een bepaald antigeen.

1. DNA-detectiemethoden:

Voor de detectie van verschillende ziekten zijn verschillende methoden bedacht, gebaseerd op de op een bepaalde manier opgebouwde sequentie van DNA.

Enkele methoden die hier worden besproken, zijn:

(a) Detectie van een pathogeen organisme door nucleïnezuurhybridisatie

(b) Diagnose van genetische ziekte met behulp van restrictie-endonuclease

(c) Diagnose van genetische ziekte door PCR/oligonucleotide-ligatietest (PCR/OLA) en

(d) detectie van mutanten op verschillende plaatsen binnen één gen.

(a) Detectie van een pathogeen organisme door nucleïnezuurhybridisatie:

Het ziekteverwekkende (pathogeen­ic) organisme kan heel specifiek worden gedetecteerd in biologische monsters door nucleïnezuurhybridisatie, dwz als de nucleïnezuursequentie van een ziekteverwekkend organisme aanwezig is in het bloed, urine, feces, enz., dan kan het worden gehybridiseerd met een nucleïnezuurprobe die complementair is aan de sequentie van dit doelnucleïnezuur. Als het patho­gene organisme in het biologische monster aanwezig is, vindt hybridisatie plaats en zo niet, dan is er geen hybridisatie.

De parasiet Plasmodium falciparum veroorzaakt malaria bij de mens. Een specifiek gen (en dus het product ervan) is de veroorzaker van deze parasiet. Een complementaire DNA-probe voor dit gen wordt chemisch gesynthetiseerd met radioactief gemerkt 32P. Deze probe is gebonden aan een membraandrager. Vervolgens wordt het te analyseren biologische monster toegevoegd, onder geschikte omstandigheden van temperatuur en ionsterkte om basenparing tussen de probe en het doel-DNA in het monster te bevorderen.

Het wordt vervolgens gewassen om de overmaat van het monster te verwijderen en vervolgens wordt het gehybridiseerde dubbelstrengs DNA geëxtraheerd en worden de hybride sequenties gedetecteerd door autoradiografie. De gekozen specifieke DNA-probe zal alleen hybridiseren met P. falciparum, maar niet met P. vivax, P. cyanomolgi of menselijk DNA. Deze sonde kan slechts 10 picogram gezuiverd P. falciparum-DNA of 1 nanogram P. falciparum-DNA in bloedmonsters detecteren. Als er hybridisatie heeft plaatsgevonden dan is het pathogene organisme aanwezig en als er geen hybridisatie plaatsvindt (d.w.z. geen bestralingen) dan is het pathogene organisme afwezig.

De bovenstaande procedure wordt toegepast voor de detectie van alle pathogene organismen in elk biologisch monster. Hier is het nadeel van het gebruik van radioactieve fosfor dat het gevaarlijk is, daarom worden tegenwoordig niet-radioactieve hybridisatieprocedures gebruikt. Bij deze methode wordt al het DNA uit het monster geëxtraheerd en aan een drager gebonden, waarna de met biotine gelabelde DNA-probe die complementair is aan het pathogene DNA, wordt gehybridiseerd en verkleind tot het doel-DNA.

Vervolgens wordt ofwel avidine ofwel streptavidine toegevoegd, dat zal binden aan de biotine op het gehybridiseerde probe-target-DNA. Vervolgens wordt een met biotine gelabeld enzym zoals alkalische fosfatase toegevoegd dat zich bindt aan het avidine dat op de sonde is gebonden. Vervolgens wordt het voor dit enzym specifieke substraat toegevoegd, waardoor het kleurloze substraat wordt omgezet in een gekleurd product. Het verschijnen van de kleur duidt op de aanwezigheid van het pathogene DNA en het niet ontwikkelen van de kleur is een indicatie van de afwezigheid van het organisme.

(b) Diagnose van genetische ziekte met behulp van restrictie-endonuclease:

Sikkelcelanemie is een genetische ziekte die wordt veroorzaakt door de verandering in een enkele nucleotide in het codon voor het zesde aminozuur van de bètaketen van het hemoglobinemolecuul. Het gen voor bètaglobine bij normale personen wordt aangeduid als A/A, bij heterozygote personen als A/a en bij homozygote personen als S/s. Personen die het sikkelgen bevatten, worden gescreend voordat de symptomen tot uiting komen en voor het screenen van de drager, die het risico loopt dit gen op hun nakomelingen over te dragen.

Het principe voor de detectie is dat er binnen het bètaglobinegen van een normaal individu drie plaatsen zijn voor het restrictie-endonuclease Cvn-1, maar in het sikkelcelgen gaat een van deze plaatsen verloren door vervanging van het enkele nucleotide .

In het normale gen is de DNA-sequentie CCTGAGG, terwijl in het sikkelcelanemie-gen de sequentie CCTGTGG is. Verder is de herkenningssequentie en plaats van splitsing door Cvn-1 CCTNAGG. Het verschil in sequentie van normaal en sikkelcelgen in de herkenningsplaats van Cvn-1 vormt dus de basis van deze DNA-diagnose.

Twee primers met sequenties die kunnen paren binnen de Cvn-1-plaatsen in het bètaglobinegen worden toegevoegd en dit deel van het DNA wordt geamplificeerd met behulp van P.C.R. en vervolgens verteerd met Cvn-1. Tenslotte worden de splitsingsproducten gescheiden door gelelektroforese en gekleurd door ethidiumbromide.

De resultaten geven aan dat in het normale gen vier DNA-fragmenten worden verkregen met 88, 181, 201 en 256 basenparen. Maar bij heterozygote individuen worden vijf DNA-fragmenten verkregen die 88, 181, 201, 256 en 382 basenparen bevatten en bij homozygote individuen worden slechts drie fragmenten verkregen met 88, 256 en 382 nucleotidenbasenparen, wat wijst op het verlies van een van de herkenningsplaatsen in het sikkelcelgen.

(c) Diagnose van genetische ziekte door middel van PCR/OLA-procedure:

Deze procedure wordt toegepast voor die aandoeningen, als gevolg van genetische mutaties, die de restrictie-endonucleaseplaatsen niet beïnvloeden. Laten we een voorbeeld nemen van een gen dat een mutatie heeft ondergaan op positie 98. Op deze specifieke plaats is het basenpaar in het normale gen C=G en in het mutante gen is het A=T.

Twee oligonucleotiden van elk ongeveer 20 nucleotiden lang worden gesynthetiseerd met een sequentie die complementair is aan een van de strengen van dit gen aan weerszijden van positie 98. Een van deze oligonucleotiden heeft biotine aan het 5'8242 uiteinde en '8216C'8217 als het terminale nucleotide aan het 3′ uiteinde. De andere oligonucleotide-probe heeft ‘A'8217 basennucleotide aan het 5'8242-uiteinde en digoxigenine (verbinding ‘D'8217) aan het 3'8242-uiteinde.

Het doel-DNA wordt geamplificeerd door PCR en wordt vervolgens gehybridiseerd met de gesynthetiseerde probes. De twee probes basenpaar zodanig dat het 5'8242 uiteinde van de 2e probe naast het 3'8242 uiteinde van de 1e probe ligt. Vervolgens wordt DNA-ligase toegevoegd, dat alleen het normale DNA-fragment zal ligeren, maar niet het gemuteerde fragment dat is gehybridiseerd met de probes.

Dit komt door de mismatch tussen de 2e probe en het gemuteerde gen, dat geen basenpaar kan hebben. Verder, om te bepalen of ligatie heeft plaatsgevonden of niet, worden de hybride probes in een putje gebracht dat avidine bevat dat bindt aan biotine. Daarna wordt het gewassen, waardoor de niet-geligeerde sonde wordt verwijderd.

Vervolgens wordt anti-digoxigenine ('8216D'8217 verbinding) antilichaam-alkalische fosfatase-conjugaat toegevoegd en gewassen in beide putjes (de normale en gemuteerde gehybridiseerde probes). Verwacht wordt dat het antilichaamenzym alleen aan de geligeerde sonde goed zal binden. Wanneer substraat wordt toegevoegd, wordt het gekleurde product alleen geproduceerd in het putje waar ligatie heeft plaatsgevonden, terwijl er geen kleur wordt gevormd waar geen ligatie heeft plaatsgevonden.

(d) Detectie van mutaties op verschillende plaatsen binnen één gen:

Bèta-thalassemie is een genetische ziekte die wordt veroorzaakt door mutatie in bèta-globuline op acht of meer plaatsen, wat resulteert in een lage synthesesnelheid. Dus in plaats van elke mutatie afzonderlijk te detecteren, worden alle acht sites tegelijkertijd gescand.

DNA-probes worden gesynthetiseerd naar al deze acht plaatsen van het bètaglobinegen waar mutaties worden verwacht. Elke probe heeft een lengte van 20 nucleotiden met een poly-T'8217-staart aan het 3'8242-uiteinde. Dit wordt gebruikt om de sonde aan een membraan te bevestigen. Segmenten van het monster-DNA (bèta-gen) dat elk van de mogelijke mutante plaatsen omvat, worden geamplificeerd door PCR, met behulp van primers die zijn gelabeld met biotine aan het 5'8242-uiteinde.

Het geamplificeerde doelwit-DNA wordt vervolgens gehybridiseerd en gehybridiseerd met de membraangebonden probes onder omstandigheden die alleen perfecte matches toestaan ​​om te hybridiseren. Vervolgens wordt streptavidine met aangehechte alkalische fosfatase toegevoegd, wordt het membraan gewassen en wordt een kleurloos substraat toegevoegd.

Een gekleurde vlek op het membraan verschijnt overal waar er een perfecte nucleotide-match is tussen het geamplificeerde doel-DNA-segment en een van de specifieke oligoneucleotide-probes. Waar geen hybridisatie is (gemuteerde DNA-segmenten) verschijnt geen kleur. In de onderstaande illustratie zijn gen 1 en 2 gemuteerd, maar gen 3 is normaal. (Voorgesteld als respectievelijk sonde 1, 2 en 3 in de figuur).

2. Immunologische methoden:

Antilichaammoleculen bestaan ​​uit vier ketens, twee identieke lichte ketens en twee identieke zware ketens. Het fv-gebied (variabel fragment) van elk antilichaammolecuul bindt stevig aan een specifieke plaats (epitoop) op een antigeen. Deze specificiteit wordt gebruikt om de aanwezigheid van een bepaald epitoop van een ziekteverwekkend molecuul of organisme in een biologisch monster te identificeren. Er zijn twee methoden waarmee de antigeen-antilichaamreactie of binding wordt gedetecteerd.

(a) Radio-immunotest (RIA):

De concentratie van progesteron in bijvoorbeeld bloed wordt bepaald door RIA. Allereerst worden antilichamen tegen progesteron opgewekt en opgenomen in een reageerbuis met glasparels. De antilichamen worden gemakkelijk aan de glasparels gehecht. Vervolgens wordt een progesteron-bevattend monster toegevoegd aan deze reageerbuis die de antilichamen bindt die een antigeen-antilichaamcomplex vormen, waarvan de concentratie afhangt van de hoeveelheid progesteron in het bloedmonster.

Er wordt nog een reageerbuis genomen en de antilichamen worden gelabeld met radioactieve verbindingen zoals 123 I of 3 H of 14 C. Dit radioactief gemerkte antilichaam wordt vervolgens toegevoegd aan de eerste reageerbuis die progesteron bevat dat is gehecht aan niet-gelabelde antilichamen. Radiogelabelde antilichamen zullen zich nu hechten aan het progesteron en een gelabeld antigeen-antilichaamcomplex vormen dat wordt gemeten met behulp van een scintillatieteller.

(b) Enzym-gekoppelde immunosorbent-assay (ELISA):

Het monster dat getest moet worden op de aanwezigheid van een specifiek molecuul of organisme wordt gebonden aan een vaste drager zoals een plastic plaat. Vervolgens wordt een markerspecifiek antilichaam (primair antilichaam) aan het gebonden materiaal toegevoegd en vervolgens wordt de drager gewassen om ongebonden primair antilichaam te verwijderen.

Vervolgens wordt een tweede antilichaam (secundair antilichaam) toegevoegd, dat specifiek bindt aan het primaire antilichaam en niet aan het doelmolecuul. Het secundaire antilichaam bevat gebonden enzym zoals alkalische fosfatase dat de omzetting van een kleurloos substraat in een gekleurd product katalyseert. Het systeem wordt opnieuw gewassen om eventueel niet-gebonden secundair antilichaam-enzymcon­jugaat te verwijderen.

Vervolgens wordt een kleurloos substraat toegevoegd dat alleen wordt omgezet in een gekleurd product als het specifieke antigeen aanwezig is, zo niet is er geen kleur. Als er geen antigeen (of de veroorzaker) is, zal het primaire antilichaam niet binden aan de doelplaats in het monster, vandaar dat de eerste wasstap het verwijdert. Bijgevolg heeft het secundaire antilichaam-enzymenconjugaat niets om aan te binden en wordt het verwijderd tijdens de tweede wasstap, en het uiteindelijke mengsel blijft kleurloos.

Omgekeerd, als het antigeen (of de veroorzaker) of de doelplaats in het monster aanwezig is, bindt het primaire antilichaam eraan, bindt het secundaire antilichaam aan het primaire antilichaam en zal het aangehechte enzym de reactie katalyseren van een gekleurd product die colorimetrisch kan worden gedetecteerd.

Moleculaire behandeling of gentherapie:

Om een ​​genetische ziekte te behandelen, moet het normale gen voor die ziekte worden gesequenced en gekloond. Dit gekloonde normale gen kan worden gebruikt om het defect te corrigeren bij individuen die een gemuteerde vorm van dat gen hebben. Hier is het doel om een ​​normaal functionerend gen toe te voegen aan defecte cellen, waardoor het benodigde eiwit wordt geleverd en de genetische ziekte wordt gecorrigeerd. Bovendien zal het nodig zijn om de overexpressie van een gedereguleerd normaal gen bij sommige ziekten te voorkomen.

Er zijn drie methoden voor de therapie van genetische ziekten:

(2) In vivo gentherapie en

(een) Ex vivo gentherapie:

Somatische cellen van een getroffen persoon worden verzameld. De geïsoleerde cellen worden in kweek gekweekt. Deze cellen worden vervolgens getransfecteerd door retrovirale kloneringsvectoren die het remediërende genconstruct bevatten. De cellen worden verder gekweekt en die cellen die het gen van belang bevatten, worden geselecteerd en uiteindelijk terug getransplanteerd of getransfundeerd in de patiënt. Deze getransplanteerde getransfecteerde cellen zullen het genproduct, d.w.z. het eiwit, synthetiseren. Voorbeelden van dit type behandeling zijn gaucheziekte, sikkelcelanemie, thalassemie enz.

(B) In vivo gentherapie:

Bij dit type behandeling is er de directe afgifte van het remediërende gen in de cellen van een bepaald weefsel van de patiënt, met behulp van retrovirale vectoren. Zelfs plasmide-DNA-constructies
worden gebruikt. Dit type behandeling wordt gebruikt bij patiënten met spierdystrofie, neuronale degeneratie en hersenkanker.

(c) Antisense-therapie:

Antisense-therapie is ontworpen om de expressie van een specifiek gen te voorkomen of te verlagen. Bij sommige soorten genetische ziekten en kankers worden de genen gedereguleerd of tot overexpressie gebracht, wat resulteert in de productie van een overmaat van het genproduct of de continue aanwezigheid ervan in de cel zal de normale werking van de cel verstoren.

Bij dit soort ziekten zal de toevoeging van een normaal gen het probleem niet oplossen, maar het blokkeren van de synthese van het genproduct (eiwit) zal nuttig zijn. Bij anti-sense therapie wordt dus een nucleïnezuursequentie in de doelcel geïntroduceerd die complementair is aan het completeren van of een deel van dat specifieke mRNA.

Daarom zal het mRNA dat wordt geproduceerd door de normale transcriptie van het gen hybridiseren met het antisense-oligonucleotide door basenparing, waardoor de translatie van dit mRNA wordt voorkomen, wat resulteert in een verminderde hoeveelheid doeleiwit. De antisense-therapie wordt gebruikt bij de behandeling van verschillende vormen van kanker, aids, atherosclerose, leukemie en sikkelcelanemie.


Resultaten

Patiëntkenmerken

De pasgeborenen in de niet-geïnfecteerde groep hadden een gemiddeld geboortegewicht van 1774 g, een zwangerschapsduur van 32 weken en een gemiddelde van 20 katheterdagen. De geïnfecteerde groep (met CLABSI) had een gemiddeld geboortegewicht van 1454 g, een zwangerschapsduur van 30 weken en een gemiddelde van 24 katheterdagen. Op één na kregen alle pasgeborenen een antibioticabehandeling, met een gemiddelde duur van 8 dagen voor niet-CLABSI-groepen en 11 dagen voor CLABSI-groepen. Ampicilline en Gentamicine werden ofwel alleen of in combinatie met andere antibiotica toegediend bij respectievelijk 97 en 93% van de totale proefpersonen (zie tabellen 1 en S1).

Bloedcultuur isolaten

Het meest voorkomende organisme dat binnen 3 dagen na verwijdering van de katheter door bloedkweek werd geïsoleerd, was coagulase-negatieve stafylokokken (CONS) (9/30, 30%), gevolgd door Staphylococcus aureus (4/30, 13.3%). S. opperhuid was de belangrijkste CONS (5/9, 55,5%) geïsoleerd uit bloedkweek (S1-tabel voor details).

16S V4 rRNA-sequencing-uitgang

Tabel 2 geeft een samenvatting van de monsters die voor het onderzoek zijn verwerkt en geanalyseerd. Een samenvatting van de sequencing-output, inclusief het aantal uitlezingen, kwaliteitsstatistieken en het aantal OTU's, wordt weergegeven in Tabel 3. De onbewerkte gegevens die zijn gegenereerd op basis van onze monsters (n = 90) hadden een gemiddelde van 32.539 uitlezingen/monster met een kwaliteitsscore van ≥Q30 van 64% (zie tabel 3). Een totaal van 7.516 reads (leesbereik: 1-354) die behoren tot 187 verschillende OTU's (OTU-abundantiebereik: 1-2.291) die zijn toegewezen als 'kingdom_bacteria', werden echter gekarakteriseerd als 'unclassified_bacteria' op phylum-niveau met behulp van de hierboven beschreven aangepaste pijplijn .

Onverwacht bleken alle OTU's die waren toegewezen als 'kingdom_bacteria phylum_unclassified_bacteria' niet-bacteriële reads te zijn, en bijna allemaal uitgelijnd met menselijk DNA met behulp van de NCBI nr / nt en de human genomic plus transcript-databases. We hebben dus de OTU's verwijderd die niet konden classificeren als bacteriën op koninkrijksniveau en niet-geclassificeerde OTU's op phylum-niveau van stroomafwaartse analyse. Na het verwijderen van niet-geclassificeerde OTU's op zowel het koninkrijk- als het phylum-niveau, leverden slechts 44 (van de 90) monsters een bruikbare hoeveelheid op kwaliteit gefilterde sequencinggegevens op (>100 reads/sample), in totaal 406.007 reads behorend tot 440 verschillende OTU's.

Toepassing van ontsmetten R-pakket

In totaal werden 28 OTU's geïdentificeerd als verontreinigende stoffen door de frequentiegebaseerde ontsmetten classificatie bij een standaarddrempel (0,1) (zie S2-tabel en S1-Fig voor details). Toepassing van de ontsmetten statistische methode voor onze steekproeven (n = 44, elk met >100-uitlezingen/steekproef) resulteerde in een gemiddelde van 9,122 aflezingen/steekproef (bereik: 96-45,180) toegewezen aan 412 verschillende OTU's (tabel 3). Downstream-analyse, inclusief bacteriële diversiteit en samenstelling, werd beoordeeld in de dataset met verwijderde verontreinigingen.

Bacteriële belasting

Monsters van geïnfecteerde katheters (n = 14) bevatten een significant hogere bacteriële belasting (lage drempelcyclus (CT)) dan de niet-geïnfecteerde katheters (n = 12) zoals gemeten met 16S rRNA-gen qPCR (Mann-Whitney-test p<0.05) ( Figuur 1). Alle negatieve controles (meest linkse drie monstersets in figuur 1) vertoonden hoge CT-waarden, wat wijst op een laag gehalte aan 16S-rRNA-gen. Daarentegen hadden ontlastingsmonsters die als positieve controles werden gebruikt, een hoge concentratie bacterieel DNA (lage CT), zoals verwacht (meest rechtse monsterset in figuur 1). De bacteriële belasting was ook significant hoger in zowel geïnfecteerde als niet-geïnfecteerde katheters dan de water- en buffercontroles (Kruskal Wallis met Dunn's post-hoc test p<0.05). Er werd geen significant verschil gevonden in de bacteriële belasting tussen de geïnfecteerde en niet-geïnfecteerde huidswabs (Mann-Whitney-test p>0.05). Er was ook geen significant verschil tussen monsters van huiduitstrijkjes en de negatieve controles (Kruskal Wallis met Dunn's post-hoc test p>0.05). We hebben geen statistische vergelijking van de bacteriële belasting tussen geïnfecteerde en niet-geïnfecteerde bloedmonsters uitgevoerd vanwege de kleine steekproefomvang.Het 16S qPCR-resultaat was vergelijkbaar met dat van het Qubit-resultaat (gemeten met behulp van PCR-geamplificeerd 16S V4-rRNA-gen) (zie S2 Fig).

qPCR-analyse van de overvloed aan bacteriële 16S-rRNA-gen in verschillende bestudeerde monsters. Aanzienlijk hogere niveaus van bacterieel DNA werden gedetecteerd in de geïnfecteerde katheters (n = 14) in vergelijking met de niet-geïnfecteerde katheters (n = 12) (Mann-Whitney-test p<0,05). *P<0.05, ns = niet-significant (p>0.05). Cath = katheter, U = niet geïnfecteerd, I = geïnfecteerd.

Alfa-diversiteit van het microbioom uit de katheter, het bloed en het huiduitstrijkje

De alfadiversiteit binnen de monsters werd gemeten in de dataset van verwijderde verontreinigingen, uitgedund tot een gelijkmatige bemonsteringsdiepte (katheter = 165 sequenties, bloed = 137 en huiduitstrijkje = 96). Er was geen statistisch significant verschil (Mann-Whitney-test p>0.05) in de microbiële rijkdom (zoals gemeten door waargenomen OTU's, figuur 2A) of diversiteit (zoals geschat door de Shannon-diversiteitsindex (SDI), figuur 2B) op basis van de CLABSI-status voor kathetermonsters. We vonden ook geen verschillen in de rijkdom en diversiteit tussen niet-geïnfecteerde en geïnfecteerde groepen in huiduitstrijkjes en bloedmonsters. Vergelijkbare resultaten werden verkregen met de niet-geraffineerde dataset (S3 Fig).

(EEN) Geobserveerde OTU's en (B) de Shannon Diversity Indices zijn weergegeven in spreidingsdiagrammen. De alfadiversiteitsstatistieken verschilden niet tussen geïnfecteerde en niet-geïnfecteerde katheters.

Bètadiversiteit van monsters van geïnfecteerde (CLABSI) en niet-geïnfecteerde pasgeborenen

Multivariate analyses van bèta-diversiteit gemeten door UniFrac-afstandsmatrices worden gepresenteerd in hoofdcoördinaatanalyse (PCoA) -plots (Fig 3A-3F). We hebben geen significante clustering waargenomen door de infectiestatus voor een van de monstertypen met behulp van ongewogen UniFrac-afstandsmatrices (Fig 3A-3C) (niet-geïnfecteerde versus geïnfecteerde groepen: PERMANOVA p & gt0.05 voor alle monstertypen). Vergelijkbare resultaten werden verkregen met gewogen UniFrac-afstanden (Fig 3D-3F). De bloedmicrobiomen van geïnfecteerde proefpersonen clusterden echter afzonderlijk van de niet-geïnfecteerde proefpersonen (zie figuur 3C).

PCoA-plots van de microbiële gemeenschappen in geïnfecteerde (rode cirkels) en niet-geïnfecteerde monsters (blauwe cirkels) van (EEN) katheterbiofilms, (B) huiduitstrijkje en (C) respectievelijk bloed zoals gemeten met ongewogen UniFrac-afstanden. Niet-geïnfecteerde bloedmonsters worden afzonderlijk van de geïnfecteerde bloedmonsters geclusterd (zie figuur 3C), maar er is geen clustering geïdentificeerd in de katheterbiofilm of microbiële gemeenschappen van huiduitstrijkjes. Vijgen NS-F vertegenwoordigt scatterplots van de gewogen UniFrac-afstandsmetrieken voor de katheter, het huiduitstrijkje en het bloedmicrobioom in niet-geïnfecteerde en geïnfecteerde groepen. Elke cirkel vertegenwoordigt de volledige microbiële gemeenschap van een biologisch monster. De eerste 2 hoofdcomponenten (PC1 en PC2), samen met de hoeveelheid uitgelegde variatie, zijn weergegeven in de figuren.

Microbiële samenstelling en structuur

Microbioomsamenstelling per specimentype.

De samenstelling van de microbiële gemeenschap verschilde per monstertype. Op basis van het specimentype vonden we een hogere relatieve abundantie van de phylum Firmicutes in zowel katheterbiofilm (BH gecorrigeerde Dunn's Kruskal-Wallis-test p = 0,03) en huiduitstrijkje (p = 0,02) in vergelijking met de abundantie in bloed (S4 Fig) . Een van de belangrijkste CLABSI-bacteriën Stafylokokken spp. werd gevonden in een significant hogere abundantie in katheters (gemiddelde relatieve abundantie = 63%) en huiduitstrijkjes (59%) dan in bloedmonsters (16%) (p<0,05 voor beide vergelijkingen, S4- en S5-figuren). Bovendien is de gemiddelde overvloed aan Streptokokken was significant hoger in katheters (6%) in vergelijking met de gemiddelde overvloed in huiduitstrijkjes (0,01%) (p = 0,0001). Andere geslachten die behoren tot Firmicutes, zoals: Enterokokken en anaerokok waren alleen aanwezig in katheterbiofilmmonsters (zie S4 en S5 Figs).

Kathetermicrobioom van CLABSI en niet-CLABSI pasgeborenen.

We vonden geen statistisch significante verschillen in relatieve abundantie van de bacteriële phyla tussen geïnfecteerde en niet-geïnfecteerde katheters (Mann-Whitney-test p>0.05, Fig 4A). Een groep bacteriën verschilt echter significant in hun relatieve abundanties tussen geïnfecteerde en niet-geïnfecteerde katheters (p & lt 0,05, zie S3-tabel en figuur 4B voor details) op genusniveau. Onder de geslachten met ≥1% gemiddelde relatieve abundanties in de groep, vonden we een significant lagere abundantie van Bradyrhizobium (p = 0,001) en Cloacibacterie (p = 0,005) in geïnfecteerde katheters in vergelijking met de niet-geïnfecteerde katheters (respectievelijk Fig 4C en 4D). Daarentegen is de relatieve overvloed aan Proteus was significant hoger (p = 0,01) in geïnfecteerde katheters dan de niet-geïnfecteerde katheters (Fig 4F). In het geval van taxa met <1% relatieve abundanties, had Staphylococcaceae_unclassified (toegewezen aan een enkele OTU-337) een hogere abundantie (p = 0,034) in de geïnfecteerde katheters vergeleken met de niet-geïnfecteerde katheters (Fig 4G), onder andere (S3-tabel) .

Staafdiagrammen die de taxonomische samenstelling van de microbiota van de katheterbiofilm op de (EEN) stam en (B) genusniveau voor niet-geïnfecteerde (n = 12) en geïnfecteerde (n = 15) katheters. Taxa met een gemiddelde relatieve abundantie <1% zijn gegroepeerd. Vergelijkingen tussen geïnfecteerde en niet-geïnfecteerde groepen maakten gebruik van een Mann-Whitney-test. Er was een significant (p<0,05) lagere abundantie van Bradyrhizobium, Cloacibacterie, en Sfingomonas in geïnfecteerde katheters in vergelijking met niet-geïnfecteerde katheters (C-E). Daarentegen hadden geïnfecteerde kathetermonsters een hoger aandeel van (F) Proteus en (G) niet-geclassificeerde Staphylococcaceae in vergelijking met de niet-geïnfecteerde katheters.

Stafylokokken, de overheersende bacteriën in huidmonsters, werd gevonden met een relatieve abundantie van meer dan 50% in zowel geïnfecteerde als niet-geïnfecteerde kathetermicrobiomen.

Huiduitstrijkjes microbioom bij CLABSI en niet-CLABSI pasgeborenen.

Microbiomen van huiduitstrijkjes van CLABSI-neonaten verschilden niet significant van die van de niet-CLABSI-individuen (Mann-Whitney-test p>0.05), zowel op phylum- als op genusniveau (Fig 5A en 5B), met uitzondering van een zeer zelden voorkomende familie niveau taxa- niet-geclassificeerde Oxalobacteraceae.

Kolommen vertegenwoordigen de gemiddelde relatieve abundantie van bacteriële taxa bij (EEN) stam en (B) geslachtsniveau voor niet-geïnfecteerde (n = 5) en geïnfecteerde (n = 6) huiduitstrijkjes verzameld van respectievelijk de niet-CLABSI- en CLABSI-neonaten. Staafdiagrammen die de relatieve abundanties van bacteriën weergeven in individuele bloedmonsters verzameld uit (C) negatief bloedkweek (niet-CLABSI) en (NS) bloedkweekpositieve (CLABSI) pasgeborenen (geïdentificeerd op de x-as). De resultaten van de bloedmicrobioom worden niet gecombineerd voor niet-geïnfecteerde en geïnfecteerde groepen, omdat elk individu binnen de groep zeer verschillend is wat betreft hun samenstelling van het bloedmicrobioom.

Microbiomen in bloedmonsters van CLABSI en niet-CLABSI pasgeborenen.

Van de zes bloedmonsters (verzameld van zes verschillende individuen) die in de uiteindelijke analyse van de bloedmicrobiomen waren opgenomen, waren drie monsters (013B, 051B en 056B) 'kweeknegatief' volgens traditionele bloedkweekmethoden en gerapporteerd als niet-geïnfecteerd (dwz niet- CLABSI). 16SV4-rRNA-sequencing van deze niet-CLABSI-bloedmonsters onthulde echter de aanwezigheid van veel bacteriële taxa, waaronder Bacteriën, Clostridiales, Helicobacteren niet-geclassificeerde Enterobacteriaceae (Fig 5C). Aan de andere kant onthulde 16S-sequencing van de 'cultuurpositieve' bloedmonsters (n = 3) alle bacteriële geslachten geïdentificeerd door traditionele op cultuur gebaseerde methoden (figuur 5D).

Kathetermicrobioom per type voeding.

Bij het vergelijken van de twee overheersende voedingsgroepen van TPN en enterale voedingen (MEBM en DEBM gecombineerd), vonden we meerdere bacteriële taxa met significant verschillende relatieve abundanties (Mann-Whitney-test p<0.05) in de kathetermicrobiomen tussen de groepen (S4-tabel). Zowel de alfa- als de bèta-diversiteit van de kathetermicrobiomen tussen de groepen was echter niet verschillend (Mann-Whitney-test van Shannon-index p>0.05, ongewogen UniFrac PERMANOVA p> 0.05).


Infectiecontrole

Gezien de behoefte aan vaak uitgebreid en nauw contact tussen patiënten en zorgpersoneel, blijft een quarantaineperiode van 14 dagen aanbevolen voor patiënten die zorg ontvangen en zorgpersoneel met blootstelling aan SARS-CoV-2 die quarantaine 1 of werkbeperkingen rechtvaardigen. Deze optie vermindert het risico van overdracht na quarantaine maximaal en is momenteel de strategie met de grootste collectieve ervaring.

Alternatieven voor de quarantaineperiode van 14 dagen worden beschreven in de opties om quarantaine te verminderen voor contacten van personen met SARS-CoV-2-infectie met behulp van symptoombewaking en diagnostische tests. Zorginstellingen zouden deze alternatieven kunnen beschouwen als een maatregel om personeelstekorten, ruimtebeperkingen of tekorten aan PBM-voorraad te verminderen, maar vanwege de speciale aard van de zorgomgeving (bijv. patiënten met een risico op slechtere resultaten, kritieke aard van zorgpersoneel, uitdagingen met sociale afstand), niet als voorkeursoptie.

Zorginstellingen moeten begrijpen dat het verkorten van de duur van de werkbeperking of de quarantaine van de patiënt een extra overdrachtsrisico met zich mee kan brengen. Ze moeten patiënten en medisch personeel ook adviseren over de noodzaak om te controleren op en onmiddellijk zichzelf te isoleren als symptomen optreden gedurende de 14 dagen na hun blootstelling en het belang van het volgen van alle aanbevolen niet-farmaceutische interventies.

1 In zorgomgevingen worden patiënten in quarantaine doorgaans geïsoleerd in een eenpersoonskamer en verzorgd door medisch personeel dat alle PBM gebruikt die worden aanbevolen voor een patiënt met een vermoedelijke of bevestigde SARS-CoV-2-infectie. Deze patiënten mogen echter niet worden samengevoegd met patiënten met een SARS-CoV-2-infectie, tenzij door middel van testen ook is bevestigd dat ze een SARS-CoV-2-infectie hebben.

CDC beveelt momenteel aan dat asymptomatische patiënten en bewoners die zijn hersteld en binnen 3 maanden na een positieve test op SARS-CoV-2-infectie zijn, mogelijk niet in quarantaine of getest hoeven te worden na hernieuwde blootstelling aan SARS-CoV-2. Er kunnen echter klinische scenario's zijn waarin de zekerheid bestaat over een eerdere infectie of de duurzaamheid van de immuunrespons, waarvoor zorgverleners zouden kunnen overwegen om te testen op SARS-CoV-2 en quarantaine aan te bevelen na een blootstelling die minder dan 3 maanden na hun initiële infectie. Voorbeelden kunnen zijn:

  • Patiënten of bewoners met onderliggende immuuncompromitterende aandoeningen (bijv. patiënt na orgaantransplantatie) of die immuungecompromitteerd raken (bijv. chemotherapie krijgen) in de 3 maanden na SARS-CoV-2-infectie en die mogelijk een verhoogd risico hebben op herinfectie. Er zijn echter geen gegevens beschikbaar over welke specifieke omstandigheden tot een hoger risico kunnen leiden en over de omvang van het risico.
  • Patiënten of bewoners voor wie er bezorgdheid bestaat dat hun initiële diagnose van SARS-CoV-2-infectie gebaseerd zou kunnen zijn op een vals-positief testresultaat (bijv. de bewoner was asymptomatisch, antigeentest positief en een bevestigende nucleïnezuuramplificatietest (NAAT) niet uitgevoerd).
  • Patiënten of bewoners voor wie er aanwijzingen zijn dat ze zijn blootgesteld aan een nieuwe SARS-CoV-2-variant (bijv.

CDC blijft actief onderzoek doen naar de frequentie van herinfectie en de omstandigheden rond deze afleveringen, inclusief de rol die nieuwe varianten kunnen spelen bij herinfectie, en zal de begeleiding indien nodig aanpassen naarmate er meer informatie beschikbaar komt.

Ja. Om patiënten en zorgpersoneel (HCP) gezond en veilig te houden, zijn de richtlijnen voor infectiepreventie en -bestrijding van het CDC van toepassing op alle instellingen waar gezondheidszorg wordt verleend. Zoals bij elke begeleiding kunnen faciliteiten echter bepaalde aanbevelingen afstemmen op hun omgeving. Intramurale psychiatrische zorg omvat bijvoorbeeld gemeenschappelijke ervaringen en groepsactiviteiten die mogelijk moeten worden voortgezet. Als dat het geval is, moeten deze activiteiten mogelijk worden aangepast om in overeenstemming te zijn met de aanbevelingen voor sociale afstand. Andere aanbevolen maatregelen voor infectiebeheersing (bijvoorbeeld zorgen voor toegang tot handdesinfecterend middel op basis van alcohol, cohorten van patiënten met COVID-19 en het toewijzen van toegewijd personeel, of het implementeren van universele broncontrolemaatregelen) zijn mogelijk niet veilig of geschikt om op alle locaties of voor iedereen te implementeren patiënten vanwege veiligheids- en gedragsproblemen.

Uitdagingen en mogelijke oplossingen die specifiek zijn voor gedragsmatige gezondheidsinstellingen kunnen zijn:

  • Cohorten
    • Uitdaging: Om overdracht te voorkomen, wordt over het algemeen aanbevolen dat patiënten met COVID-19 worden overgebracht naar een apart gedeelte van de faciliteit waar ze kunnen worden verzorgd door een toegewijde HCP. Vanwege veiligheidsproblemen of gespecialiseerde zorgbehoeften is het misschien niet mogelijk om bepaalde patiënten samen te brengen of de aan hun zorg toegewezen zorgverlener te wijzigen.
    • Mogelijke oplossingen: Wanneer cohorting niet mogelijk is, implementeer dan maatregelen om de sociale afstand (minimaal 1,8 meter) tussen patiënten met COVID-19 en anderen op de afdeling te bewaren. Idealiter zou dit een aparte badkamer voor COVID-19-patiënten omvatten. Zorg ervoor dat zorgverleners alle aanbevolen persoonlijke beschermingsmiddelen (PBM) dragen bij de zorg voor patiënten met vermoedelijke of bevestigde COVID-19.
    • Uitdaging: Groepsbegeleiding, therapie en discussiesessies zijn een cruciaal onderdeel van psychiatrische behandelings- en zorgplannen, maar de traditionele opzet voor deze activiteiten is niet verenigbaar met de aanbevelingen voor sociale afstand.
    • Potentiële oplossingen: Gebruik indien mogelijk virtuele methoden of verklein de groepsgrootte zodat de sociale afstand kan worden gehandhaafd. In het geval dat COVID-19 in de faciliteit wordt overgedragen, moeten de sessies worden gestopt of verplaatst worden naar een videodiscussieforum totdat er aanvullende infectiepreventiemaatregelen zijn genomen om de verspreiding te stoppen.
    • Uitdaging: Voor sommige patiënten kan het gebruik van stoffen gezichtsbedekkingen of gezichtsmaskers een bijkomend gevaar vormen of ongemak veroorzaken. Sommige patiënten kunnen of willen ze mogelijk niet gebruiken zoals bedoeld. Elastische en stoffen banden kunnen worden gebruikt om zichzelf of anderen te wurgen, en metalen neusbruggen kunnen worden gebruikt voor zelfbeschadiging of als wapen.
    • Mogelijke oplossingen: Overweeg patiënten met een laag risico op misbruik toe te staan ​​om stoffen gezichtsbedekkingen of gezichtsmaskers te dragen, met een voorkeur voor mensen met korte oorlussen in plaats van langere banden. Overweeg het gebruik van stoffen gezichtsbedekking of gezichtsmaskers tijdens groepsactiviteiten onder toezicht. Zorg ervoor dat zorgverleners die interactie hebben met patiënten die geen stoffen gezichtsbedekking of gezichtsmasker kunnen dragen, oogbescherming en een gezichtsmasker dragen (of een gasmasker als wordt vermoed dat de patiënt COVID-19 heeft en er ademhalingstoestellen beschikbaar zijn).
    • Uitdaging: Hoewel handdesinfecterend middel op alcoholbasis (ABHS) met 60-95% alcohol een belangrijk hulpmiddel is om de naleving van de aanbevelingen voor handhygiëne te vergroten, moet ABHS zorgvuldig worden gebruikt in psychiatrische instellingen om ervoor te zorgen dat het niet door patiënten wordt ingenomen.
    • Mogelijke oplossingen: Overweeg om ABHS niet te plaatsen in patiëntenkamers in psychiatrische instellingen, noch op locaties waar de patiënten zonder toezicht toegang hebben. Stimuleer frequent handen wassen met water en zeep voor patiënten en HCP. Overweeg om persoonlijke ABHS-dispensers in zakformaat aan te bieden voor zorgverleners.
    • Uitdaging: Als onderdeel van social distancing wordt gemeenschappelijk dineren over het algemeen niet aanbevolen. Het eten moet echter onder toezicht blijven vanwege het potentieel voor zelfbeschadiging met eetgerei en omdat veelgebruikte psychiatrische medicijnen bijwerkingen kunnen veroorzaken (bijv. tardieve dyskinesie, dysfagie, hypo- en hypersalivatie) die het verstikkingsrisico voor patiënten verhogen.
    • Potentiële oplossingen: Een optie is om personeel in patiëntenkamers te plaatsen om toezicht te houden op hun eetpatroon. Een andere optie is om gemeenschappelijk dineren in ploegendiensten toe te staan, zodat het personeel patiënten kan controleren en ervoor kan zorgen dat ze minstens 1,80 meter uit elkaar blijven. Een derde optie is om patiënten in stoelen op de juiste afstand van elkaar in de gang buiten hun kamer te laten zitten, zodat ze tijdens het eten in de gaten kunnen worden gehouden.
    • Uitdaging: Een groter deel van de psychiatrische patiënten rookt sigaretten in vergelijking met de algemene bevolking. Patiënten kunnen samenkomen in rookruimtes buiten zonder gepaste sociale afstand te nemen.
    • Mogelijke oplossingen: Beperk het aantal patiënten dat tegelijkertijd toegang heeft tot rookruimtes en plaats personeel om te observeren en ervoor te zorgen dat patiënten de juiste fysieke afstand nemen.

    Faciliteiten moeten voldoen aan de rapportagevereisten van hun staat of rechtsgebied. Degenen die worden gereguleerd door de Centers for Medicare and Medicaid Services (CMS) (bijv. verpleeghuizen) moeten ook alle CMS-vereisten extern pictogram volgen, die worden bijgewerkt met nieuwe vereisten voor rapportage aan CDC en aan bewoners en hun vertegenwoordigers.

    Bovendien beveelt CDC aan dat gezondheidsafdelingen onmiddellijk worden geïnformeerd over:

    • Bewoners of zorgpersoneel (HCP) met vermoedelijke of bevestigde COVID-19,
    • Bewoners met een ernstige luchtweginfectie resulterend in ziekenhuisopname of overlijden, en
    • &ge 3 bewoners of zorgverleners met nieuwe luchtwegsymptomen binnen 72 uur na elkaar.

    Deze kunnen wijzen op een uitbraak van COVID-19 of een andere luchtwegaandoening in de faciliteit. De gezondheidsafdeling kan belangrijke richtlijnen geven om te helpen bij het vinden van gevallen en het stoppen van de overdracht.

    De faciliteit moet ook een plan en mechanisme hebben om regelmatig te communiceren met bewoners, familieleden en HCP, ook als er gevallen van COVID-19 in de faciliteit worden vastgesteld. Vaak wordt informatie in verpleeghuizen gecommuniceerd via gemeentehuisvergaderingen en personeelsvergaderingen, samen met brieven of e-mails. Tijdens de COVID-19-pandemie mogen persoonlijke bijeenkomsten echter niet plaatsvinden. In plaats daarvan moet communicatie plaatsvinden via virtuele vergaderingen via telefoon of webplatforms. Deze moeten worden aangevuld met schriftelijke mededelingen die contactgegevens bevatten van een personeelslid dat kan reageren op vragen of zorgen. De communicatie moet informatie bevatten over de huidige situatie, plannen om de verspreiding binnen de faciliteit te beperken en aanbevolen acties die zij kunnen nemen om zichzelf en anderen te beschermen. Faciliteiten moeten deze informatie tijdig beschikbaar stellen en periodieke updates aanbieden naarmate de situatie zich ontwikkelt en er meer informatie beschikbaar komt.

    Nee. Voor patiënten die in het ziekenhuis zijn opgenomen met een SARS-CoV-2-infectie, moeten beslissingen over ontslag uit het ziekenhuis gebaseerd zijn op hun klinische status en het vermogen van een accepterende instelling om aan hun zorgbehoeften te voldoen en zich te houden aan de aanbevolen procedures voor infectiepreventie en -bestrijding. Beslissingen over ontslag uit het ziekenhuis zijn verschillend van beslissingen over stopzetting van op transmissie gebaseerde voorzorgsmaatregelen.

    Voor patiënten met een vermoedelijke of bevestigde SARS-CoV-2-infectie, moeten beslissingen over het stopzetten van op transmissie gebaseerde voorzorgsmaatregelen gebaseerd zijn op de hier beschreven strategieën. De op testen gebaseerde strategie wordt alleen aanbevolen voor gebruik in beperkte omstandigheden.

    Als een patiënt met vermoedelijke of bevestigde SARS-CoV-2-infectie heeft niet voldoen aan de criteria voor het stopzetten van op transmissie gebaseerde voorzorgsmaatregelen, moeten ze worden overgebracht naar een faciliteit met de mogelijkheid om zich te houden aan de aanbevelingen voor infectiepreventie en -bestrijding voor de zorg voor bewoners met een SARS-CoV-2-infectie, inclusief plaatsing in een eenheid of gebied van de faciliteit aangewezen om te zorgen voor bewoners met een SARS-CoV-2-infectie en het verstrekken van aanbevolen persoonlijke beschermingsmiddelen aan medisch personeel.

    Als de patiënt heeft voldoen aan de criteria voor het stopzetten van op transmissie gebaseerde voorzorgsmaatregelen, vereisen ze geen aanvullende beperkingen.

    Een patiënt die in het ziekenhuis is opgenomen voor niet-COVID-gerelateerde ziekten en waarvan niet bekend is dat hij een SARS-CoV-2-infectie heeft, kan zonder testen worden overgebracht naar een verpleeghuis. Om ervoor te zorgen dat een patiënt niet werd blootgesteld en vervolgens een SARS-CoV-2-infectie zou kunnen ontwikkelen, moeten verpleeghuizen de patiënt gedurende 14 dagen na opname onder voorzorgsmaatregelen op basis van transmissie in een aparte observatieruimte of in een eenpersoonskamer plaatsen.

    Als onderdeel van universele broncontrolemaatregelen moeten alle bewoners (inclusief die beschreven in de bovenstaande scenario's) een stoffen gezichtsbedekking of gezichtsmasker (indien getolereerd) dragen wanneer ze hun kamer verlaten.

    Als onderdeel van routinepraktijken moet zorgpersoneel (HCP) standaardvoorzorgsmaatregelen toepassen. De beroepsbeoefenaar in de gezondheidszorg moet altijd opzettelijk de potentiële risico's van blootstelling aan besmettelijk materiaal beoordelen voordat hij zich bezighoudt met activiteiten en procedures in de gezondheidszorg. Op basis van hun risicobeoordeling moeten veilige werkpraktijken, waaronder technische controles die het vrijkomen van besmettelijk materiaal verminderen, administratieve controles en het gebruik van persoonlijke beschermingsmiddelen (PBM) worden geïmplementeerd op het zorgpunt volgens de CDC-richtlijnen en praktijknormen voor de verrichte activiteit.

    Om de blootstelling aan SARS-CoV-2 tijdens de COVID-19-pandemie te verminderen, beveelt CDC aan dat faciliteiten:

    • overwegen niet-operatieve benaderingen indien mogelijk
    • minimaliseer het gebruik van procedures of technieken die infectieuze aerosolen kunnen produceren indien mogelijk
    • minimaliseer het aantal mensen in de operatie- of procedurekamer om blootstelling te verminderen
    • gebruik maken van de mate van overdracht door de gemeenschap en een beoordeling van de waarschijnlijkheid van schade aan de patiënt als de zorg wordt uitgesteld om beslissingen te nemen over het annuleren of uitstellen van electieve operaties en procedures en
    • universele broncontrolemaatregelen implementeren, waaronder het dragen van een stoffen gezichtsbedekking (zoals getolereerd) van patiënten en het te allen tijde laten dragen van een gezichtsmasker in de zorginstelling.

    Als chirurgie of procedures niet kunnen worden uitgesteld, moet de zorgverlener die zorgt voor patiënten met vermoedelijke of bevestigde COVID-19, zich houden aan alle aanbevolen procedures voor infectiepreventie en -controle voor COVID-19. Dit bevat:

    • Gebruik van alle aanbevolen persoonlijke beschermingsmiddelen: een N95 of gelijkwaardig of hoger ademhalingstoestel (of gezichtsmasker als ademhalingstoestellen niet beschikbaar zijn), oogbescherming, handschoenen en een schort.
      • Ademhalingstoestellen met uitademventielen mogen niet worden gebruikt tijdens chirurgische ingrepen, omdat ongefilterde uitgeademde lucht het steriele veld in gevaar zou brengen.
      • Als er tekorten zijn, moet prioriteit worden gegeven aan N95 of gelijkwaardige of hogere ademhalingstoestellen voor procedures waarbij technieken met een hoger risico betrokken zijn (bijv. luchtwegen).

      Omdat SARS-CoV-2 kan worden overgedragen door personen die geïnfecteerd zijn maar geen symptomen hebben, zullen sommige geïnfecteerde personen niet worden geïdentificeerd door screening op klinische tekenen en symptomen. Professionele zorgverleners die chirurgische of procedurele zorg verlenen aan patiënten waarvan niet wordt vermoed dat ze een SARS-CoV-2-infectie hebben, moeten een gelaagde benadering gebruiken op basis van het niveau van overdracht door de gemeenschap om de noodzaak van universele oogbescherming en het gebruik van ademhalingstoestellen te informeren. HCP moet oogbescherming of een N95 of gelijkwaardig of hoger ademhalingsapparaat blijven gebruiken wanneer dit wordt aanbevolen voor patiëntenzorg als onderdeel van standaard of op transmissie gebaseerde voorzorgsmaatregelen.

      Naast het gebruik van universele PBM en broncontrole in zorginstellingen, kunnen gerichte SARS-CoV-2-tests van patiënten zonder tekenen of symptomen van COVID-19 worden gebruikt om patiënten met een asymptomatische of presymptomatische SARS-CoV-2-infectie te identificeren en het risico op blootstelling in sommige zorginstellingen verder te verminderen. Afhankelijk van de richtlijnen van lokale en nationale gezondheidsafdelingen, de beschikbaarheid van testen en hoe snel de resultaten beschikbaar zijn, kunnen faciliteiten overwegen om pre-toelating of pre-procedure diagnostische testen uit te voeren met geautoriseerde nucleïnezuur- of antigeendetectie-assays voor SARS-CoV-2.
      Testresultaten kunnen informatie geven over beslissingen over het opnieuw plannen van electieve procedures of over de noodzaak van aanvullende op transmissie gebaseerde voorzorgsmaatregelen bij de zorg voor de patiënt. Beperkingen van het gebruik van deze teststrategie zijn onder meer het verkrijgen van negatieve resultaten bij patiënten tijdens hun incubatieperiode die later besmettelijk worden en vals-negatieve testresultaten, afhankelijk van de gebruikte testmethode.

      De richtlijnen van de CDC voor het gebruik van NIOSH-goedgekeurde N95 wegwerpfilters of ademhalingstoestellen van een hoger niveau bij het verlenen van zorg aan patiënten met vermoedelijke of bekende COVID-19 is gebaseerd op de huidige kennis van SARS-CoV-2 en gerelateerde ademhalingsvirussen.

      De huidige gegevens suggereren dat aërosoltransmissie op korte afstand door druppeltjes en inademing, en contact gevolgd door zelfafgifte aan de ogen, neus of mond waarschijnlijke transmissieroutes zijn. Aërosoltransmissie over lange afstand, zoals wordt waargenomen bij mazelen, is geen kenmerk van SARS-CoV-2.

      Mogelijke routes voor overdracht op korte afstand zijn onder meer spatten en sprays van infectieus materiaal op slijmvliezen en inademing van infectieuze virionen uitgeademd door een geïnfecteerde persoon. De relatieve bijdrage van elk van deze is niet bekend voor SARS-Co-V-2.

      Gezichtsmaskers die vaak worden gebruikt tijdens chirurgische ingrepen, bieden een barrièrebescherming tegen druppeltjes die in contact komen met de slijmvliezen van neus en mond, maar ze zijn niet ontworpen om dragers te beschermen tegen het inademen van kleine deeltjes. Ademhalingstoestellen van N95 en hoger, zoals andere wegwerpmaskers met filterende gezichtsmaskers, aangedreven luchtzuiverende ademhalingstoestellen (PAPR's) en elastomere ademhalingstoestellen, bieden zowel barrière- als ademhalingsbescherming vanwege hun strakke pasvorm en filtratie-eigenschappen.

      Ademhalingstoestellen moeten worden gebruikt als onderdeel van een ademhalingsbeschermingsprogramma dat het personeel medische evaluaties, training en pasvormtests biedt.

      Hoewel gezichtsmaskers routinematig worden gebruikt voor de zorg van patiënten met veelvoorkomende virale luchtweginfecties, worden N95-ademhalingstoestellen of een hoger niveau-ademhalingsapparaat routinematig aanbevolen voor opkomende pathogenen zoals SARS CoV-2, die mogelijk worden overgedragen via kleine deeltjes, het vermogen om ernstige infecties te veroorzaken, en geen specifieke behandelingen of vaccins.

      CDC-aanbevelingen erkennen de huidige uitdagingen met beperkte leveringen van N95's en andere ademhalingstoestellen. Faciliteiten die niet over voldoende N95's en andere ademhalingstoestellen beschikken voor alle patiëntenzorg, moeten prioriteit geven aan het gebruik ervan voor activiteiten en procedures die een hoog risico op het genereren van infectieuze aerosolen met zich meebrengen en gezichtsmaskers gebruiken voor zorg waarbij deze activiteiten of procedures niet betrokken zijn. Gedetailleerde strategieën voor het optimaliseren van de levering van N95-ademhalingstoestellen zijn beschikbaar op de CDC-website. Zodra de voorraden weer beschikbaar zijn, stelt de richtlijn dat het gebruik van N95 en hogere ademhalingstoestellen moet worden hervat.

      Over het algemeen moeten het vervoer en de verplaatsing van een patiënt met een vermoedelijke of bevestigde SARS-CoV-2-infectie buiten hun kamer worden beperkt tot medisch essentiële doeleinden. Bij vervoer buiten de kamer, zoals voor radiologie, moet het zorgpersoneel (HCP) in de ontvangstruimte voorafgaand aan het vervoer van de patiënt op de hoogte worden gesteld. Voor vervoer moet de patiënt een gezichtsmasker of een stoffen gezichtsbedekking dragen (indien toegestaan) om secreties op te vangen en te worden bedekt met een schoon laken.

      Als het vervoerspersoneel de patiënt moet voorbereiden op het vervoer (bijv. overbrengen naar de rolstoel of brancard), moet het vervoerspersoneel alle aanbevolen persoonlijke beschermingsmiddelen dragen (handschoenen, een schort, ademhalingsbescherming die minstens zo beschermend is als een geteste NIOSH-gecertificeerde disposable N95 filterend gezichtsmasker of gezichtsmasker&mdash als er geen masker beschikbaar is&mdashand-oogbescherming [dwz een veiligheidsbril of een wegwerpgelaatsscherm dat de voor- en zijkanten van het gezicht bedekt]). Deze aanbeveling is nodig omdat deze interacties doorgaans nauw, vaak persoonlijk contact met de patiënt in een afgesloten ruimte (bijv. patiëntenkamer) met zich meebrengen. Zodra de patiënt is overgebracht naar de rolstoel of brancard (en voordat hij de kamer verlaat), moeten vervoerders hun jas en handschoenen uittrekken en handhygiëne toepassen.

      De vervoerder moet een gasmasker of gezichtsmasker blijven dragen. Het voortgezette gebruik van oogbescherming door de vervoerder wordt ook aanbevolen als het mogelijk is dat de patiënt het gezichtsmasker of de stoffen gezichtsbedekking tijdens het vervoer niet kan verdragen. Aanvullende persoonlijke beschermingsmiddelen zouden niet nodig moeten zijn, tenzij er een verwachte noodzaak is om tijdens het vervoer medische hulp te verlenen (bijv. de patiënt helpen bij het vervangen van een losgeraakt gezichtsmasker).

      Na aankomst op hun bestemming moeten het ontvangende personeel (bijv. in de radiologie) en de vervoerder (indien assisterend bij de overdracht) handhygiëne toepassen en alle aanbevolen PBM dragen. Als de vervoerder nog steeds zijn originele gasmasker of gezichtsmasker en oogbescherming draagt, moet de vervoerder ervoor zorgen dat hij zichzelf niet besmet bij het aantrekken van de rest van de aanbevolen PBM. Deze voorzichtige benadering zal worden verfijnd en bijgewerkt naarmate er meer informatie beschikbaar komt en de responsbehoeften in de Verenigde Staten veranderen.

      Tussentijdse richtlijnen voor ambulancepersoneel dat patiënten vervoert met een bevestigde of vermoede SARS-CoV-2-infectie is hier beschikbaar. EMS-personeel moet alle aanbevolen persoonlijke beschermingsmiddelen dragen omdat ze directe medische zorg verlenen en gedurende langere tijd in nauw contact staan ​​met de patiënt.

      Over het algemeen mag alleen essentieel personeel de kamer van patiënten met een SARS-CoV-2-infectie betreden. Zorginstellingen zouden moeten overwegen om dagelijkse reiniging en desinfectie van high-touch oppervlakken toe te wijzen aan verplegend personeel dat zich al in de kamer zal bevinden om de patiënt te verzorgen. Als deze verantwoordelijkheid wordt toegewezen aan EVS-personeel, moeten ze alle aanbevolen persoonlijke beschermingsmiddelen dragen wanneer ze zich in de kamer bevinden. PBM's dienen bij het verlaten van de ruimte te worden verwijderd, onmiddellijk gevolgd door het uitvoeren van handhygiëne.

      Na het lossen kan de terminal worden schoongemaakt door EVS-personeel. Ze moeten de toegang tot de kamer uitstellen totdat de tijd is verstreken voor voldoende luchtverversingen om potentieel besmettelijke deeltjes te verwijderen. Nadat deze tijd is verstreken, kan EVS-personeel de kamer betreden en moet een gezichtsmasker (voor broncontrole) samen met een jurk en handschoenen worden gedragen bij het uitvoeren van eindschoonmaak. Oogbescherming moet worden toegevoegd als spatten of sprays tijdens reinigings- en desinfectieactiviteiten worden verwacht of anderszins vereist op basis van de geselecteerde reinigingsproducten. Overschoenen worden op dit moment niet aanbevolen voor personeel dat zorgt voor patiënten met een SARS-CoV-2-infectie.

      Bij sommige procedures die bij patiënten worden uitgevoerd, is de kans groter dat ze hogere concentraties infectieuze luchtwegaërosolen genereren dan hoesten, niezen, praten of ademen. Deze aërosolgenererende procedures (AGP's) brengen mogelijk gezondheidspersoneel en anderen met een verhoogd risico op blootstelling aan pathogenen en infectie.

      De ontwikkeling van een uitgebreide lijst van AGP's voor zorginstellingen was niet mogelijk vanwege de beperkingen in de beschikbare gegevens over welke procedures potentieel besmettelijke aerosolen kunnen genereren en de uitdagingen bij het bepalen of gerapporteerde transmissies tijdens AGP's te wijten zijn aan aerosolen of andere blootstellingen.

      Er is geen consensus onder deskundigen, noch voldoende ondersteunende gegevens om een ​​definitieve en uitgebreide lijst van AGP's voor zorginstellingen te maken.

      Vaak uitgevoerde medische procedures die vaak als AGP's worden beschouwd, of die ongecontroleerde respiratoire secreties veroorzaken, zijn onder meer:

      • open uitzuigen van luchtwegen
      • sputum inductie
      • reanimatie
      • endotracheale intubatie en extubatie
      • niet-invasieve beademing (bijv. BiPAP, CPAP)
      • bronchoscopie
      • handmatige ventilatie

      Op basis van beperkte beschikbare gegevens is het onzeker of aerosolen die bij sommige procedures worden gegenereerd, besmettelijk kunnen zijn, zoals:

      *Aerosolen die door vernevelaars worden gegenereerd, zijn afkomstig van medicatie in de vernevelaar. Het is onzeker of mogelijke associaties tussen het uitvoeren van deze algemene procedure en een verhoogd infectierisico te wijten kunnen zijn aan aerosolen die door de procedure worden gegenereerd of aan toegenomen contact tussen degenen die de vernevelde medicatie toedienen en geïnfecteerde patiënten.

      Referenties met betrekking tot procedures voor het genereren van aerosolen:

      Tran K, Cimon K, Severn M, Pessoa-Silva CL, Conly J (2012) Aerosolgenererende procedures en risico op overdracht van acute luchtweginfecties naar gezondheidswerkers: een systematische review. PLoS ONE 7(4) https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3338532/#!po=72.2222extern pictogramextern pictogram extern pictogram ).

      Hoewel wordt aangenomen dat de verspreiding van SARS-CoV-2 voornamelijk plaatsvindt via ademhalingsdruppeltjes, is de bijdrage van kleine inadembare deeltjes aan de overdracht van dichtbij op dit moment onzeker. Overdracht via de lucht van persoon op persoon over lange afstanden is onwaarschijnlijk.

      De hoeveelheid tijd dat de lucht in een onderzoekskamer potentieel besmettelijk blijft, is niet bekend en kan afhangen van een aantal factoren, waaronder de grootte van de kamer, het aantal luchtverversingen per uur, hoe lang de patiënt in de kamer was, of de patiënt hoestte of niesde, en of een aërosolgenererende procedure werd uitgevoerd. Faciliteiten moeten met deze factoren rekening houden wanneer ze beslissen wanneer de vrijgekomen kamer kan worden betreden door iemand die geen persoonlijke beschermingsmiddelen draagt.

      Bij een patiënt die niet hoestte of niesde, geen aërosolvormende procedure onderging en de kamer een korte tijd (bijv. minuten. Voor een patiënt die hoestte en langere tijd in de kamer bleef of een aërosolgenererende procedure onderging, is de risicoperiode echter waarschijnlijk langer.

      Voor deze scenario's met een hoger risico is het redelijk om een ​​vergelijkbare tijdsperiode toe te passen als die welke wordt gebruikt voor pathogenen die via de lucht worden verspreid (bijv. mazelen, tuberculose) en om te voorkomen dat zorgverleners en patiënten zonder PBM de kamer binnenkomen totdat er voldoende tijd is verstreken voor voldoende luchtwisselingen om potentieel besmettelijke deeltjes te verwijderen.

      Naast het zorgen voor voldoende tijd voor voldoende luchtverversing om potentieel besmettelijke deeltjes te verwijderen, moet de arts in de gezondheidszorg omgevingsoppervlakken en gedeelde apparatuur reinigen en desinfecteren voordat de kamer voor een andere patiënt wordt gebruikt.

      CDC heeft informatie vrijgegeven over strategieën om de levering van isolatiejassen te optimaliseren. Zorginstellingen moeten naar die richtlijnen verwijzen en de aanbevolen strategieën implementeren om hun huidige aanbod van jassen te optimaliseren. Dit omvat het verschuiven naar het gebruik van wasbare stoffen jassen, indien mogelijk.

      Het gebruik van schorten als onderdeel van voorzorgsmaatregelen bij contact in de context van MDRO's is voornamelijk geïmplementeerd om het risico van overdracht op andere patiënten te verminderen en niet om het gezondheidspersoneel (HCP) te beschermen. Faciliteiten met een tekort zouden kunnen overwegen om het gebruik van jassen voor de zorg van patiënten met endemische MDRO's, zoals MRSA, VRE en ESBL-producerende Gram-negatieve bacillen, op te schorten, behalve zoals vereist voor standaardvoorzorgsmaatregelen. Faciliteiten moeten hun lokale epidemiologie beoordelen om te bepalen welke MDRO's als endemisch worden beschouwd. Ongeacht het gebruik van schorten, moeten zorgverleners in instellingen handschoenen blijven dragen voor contact met deze patiënten en hun omgeving. Handhygiëne moet blijvend worden benadrukt. Faciliteiten moeten ook proberen om patiënten die zijn gekoloniseerd of geïnfecteerd met een MDRO in een privékamer te plaatsen, indien beschikbaar.

      • Zorg voor patiënten met zeer resistente Gram-negatieve organismen (bijv. carbapenem-resistente Enterobacteriacae) en andere MDRO's (bijv.Candida auris) die niet als endemisch worden beschouwd: In plaats van dat er voor elke kamer die binnenkomt een schort moet worden aangetrokken, moeten ze worden gereserveerd voor gebruik als onderdeel van de standaardvoorzorgsmaatregelen en moeten ze ook prioriteit krijgen voor activiteiten met veel contact voor patiëntenzorg die het grootste risico vormen voor de overdracht van ziekteverwekkers van de patiënt naar de HCP. Voorbeelden van dergelijke zorgactiviteiten met veel contact zijn onder meer aankleden, baden/douchen, verplaatsen, hygiëne bieden, linnengoed verschonen, slips verschonen of helpen bij toiletgang, verzorging of gebruik van hulpmiddelen (centrale lijn, urinekatheter, voedingssonde, tracheostomie/ventilator), en wondverzorging. Om jassen verder te behouden, wordt professionele zorgverleners aanbevolen om zorgactiviteiten met veel contact te bundelen als onderdeel van individuele zorgontmoetingen. Ongeacht het gebruik van schorten, moeten zorgverleners in instellingen handschoenen blijven dragen voor contact met deze patiënten en hun omgeving. Handhygiëne moet blijvend worden benadrukt. Faciliteiten moeten ook proberen om patiënten die zijn gekoloniseerd of geïnfecteerd met een MDRO in een privékamer te plaatsen, indien beschikbaar.
      • Zorg voor patiënten metClostridioides difficileinfecties (CDI): Faciliteiten moeten contactvoorzorgsmaatregelen blijven gebruiken (een toga en handschoenen aantrekken bij binnenkomst in de kamer van de patiënt en de patiënt in een privékamer plaatsen) voor de zorg voor symptomatische patiënten met CDI. Als onderdeel van een aanvullende strategie om overdracht van CDI te voorkomen, hebben sommige instellingen contactvoorzorgsmaatregelen geïmplementeerd voor de zorg voor patiënten met een hoog risico op CDI die asymptomatisch drager zijn van CDI. Clostridioides difficile. Er zijn beperkte gegevens over de rol van asymptomatisch dragerschap bij de overdracht van CDI. In deze setting van een kritiek nationaal tekort aan toga's, zouden faciliteiten moeten overwegen om deze aanpak op te schorten totdat het tekort is verholpen. Jassen moeten nog steeds worden gebruikt als onderdeel van de standaardvoorzorgsmaatregelen.

      Iedereen die langdurig nauw contact had (binnen een straal van 1,8 meter voor een cumulatief totaal van 15 minuten of meer gedurende een periode van 24 uur) met de geïnfecteerde zorgverlener, is mogelijk blootgesteld.

      • Als de aanbieder COVID-19-symptomen had, de zorgverlener wordt als potentieel besmettelijk beschouwd vanaf 2 dagen voordat de symptomen voor het eerst verschenen totdat de zorgverlener voldoet aan de criteria om op transmissie gebaseerde voorzorgsmaatregelen of thuisisolatie te staken.
      • Als de provider geen symptomen had, kan het verzamelen van informatie over wanneer de aanbieder mogelijk is blootgesteld, helpen om de periode te bepalen waarin ze besmettelijk waren.
        • Als een blootstelling wordt geïdentificeerd. De zorgverlener moet vanaf 2 dagen na de blootstelling als potentieel besmettelijk worden beschouwd totdat aan de criteria voor het staken van op transmissie gebaseerde voorzorgsmaatregelen of thuisisolatie is voldaan.
        • Als de datum van blootstelling niet kan worden bepaald. Met het oog op contacttracering is het redelijk om een ​​limiet van 2 dagen te gebruiken voordat het monster dat positief testte voor SARS-CoV-2 werd verzameld als uitgangspunt, en doorgaan totdat aan de criteria voor het stopzetten van op transmissie gebaseerde voorzorgsmaatregelen of thuisisolatie is voldaan .Hoewel algemeen wordt aangenomen dat de infectieperiode 10 dagen na het begin van de infectie is, is het waarschijnlijk inefficiënt om gedurende de hele 10 dagen contact op te nemen voordat het monster wordt verkregen dat positief testte op SARS-CoV-2. In de meeste situaties kan een blootgestelde provider zich niet alle contacten van de afgelopen 10 dagen herinneren. Omdat recente gegevens suggereren dat asymptomatische personen mogelijk een lagere virale last hebben bij diagnose dan symptomatische personen, kunnen de extra middelen die nodig zijn, middelen voor casusonderzoek en contactopsporing afleiden van activiteiten die de lopende overdracht waarschijnlijk zullen onderbreken.

        Contacttracering wordt over het algemeen aanbevolen voor iedereen die gedurende deze perioden langdurig nauw contact heeft gehad met de persoon met een SARS-CoV-2-infectie. Hoewel deze vraag betrekking heeft op blootstelling aan een mogelijk besmettelijke zorgverlener, worden de volgende acties ook aanbevolen als de mogelijk besmettelijke persoon een patiënt of bezoeker is.

        Aanbevolen acties voor HCP, patiënten en bezoekers:

        • Voer een risicobeoordeling uit en pas werkbeperkingen toe voor andere zorgverleners die zijn blootgesteld aan de geïnfecteerde zorgverlener op basis van het feit of deze zorgverleners langdurig en nauw contact hebben gehad en welke PBM ze droegen. Meer gedetailleerde informatie is beschikbaar in de Interim U.S. Guidance for Risk Assessment and Work Restrictions for Healthcare Persons with Potential Exposure to COVID-19.
        • Plaats blootgestelde patiënten die momenteel in de zorginstelling zijn opgenomen in de juiste op transmissie gebaseerde voorzorgsmaatregelen en controleer ze op het begin van een SARS-CoV-2-infectie tot 14 dagen na hun laatste blootstelling. .
        • Voer contacttracering uit van blootgestelde patiënten die momenteel niet zijn opgenomen in de zorginstelling en voor bezoekers zoals beschreven in Gezondheidsafdelingen: Interim Guidance on Developing a COVID-19 Case Investigation and Contact Tracing Plan.

        Zorginstellingen moeten een proces hebben om de gezondheidsafdeling op de hoogte te stellen van bekende of vermoedelijke gevallen van SARS-CoV-2-infectie, en moeten, in overleg met de lokale volksgezondheidsautoriteiten, een plan opstellen voor hoe blootstellingen in een zorginstelling zullen worden onderzocht en hoe contactopsporing zal plaatsvinden. Het plan moet het volgende aanpakken:

        • Wie is verantwoordelijk voor het identificeren van contacten en het informeren van mogelijk blootgestelde personen?
        • Hoe zullen dergelijke meldingen plaatsvinden?
        • Welke acties en follow-up worden aanbevolen voor degenen die zijn blootgesteld?

        Het traceren van contacten moet worden uitgevoerd op een manier die de vertrouwelijkheid van de betrokken personen voor zover mogelijk beschermt en in overeenstemming is met de toepasselijke wet- en regelgeving. Zorgverleners en patiënten die momenteel in de instelling zijn opgenomen of zijn overgebracht naar een andere zorginstelling, moeten voorrang krijgen bij het melden. Deze groepen hebben, indien geïnfecteerd, het potentieel om een ​​groot aantal individuen bloot te stellen met een hoger risico op een ernstige ziekte, of, in de situatie van opgenomen patiënten, zelf een hoger risico op een ernstige ziekte.

        Informatie voor gezondheidsafdelingen over case-onderzoek en contacttracering is beschikbaar in de Health Departments: Interim Guidance on Developing a COVID-19 Case Investigation and Contact Tracing Plan. Deze begeleiding kan ook nuttig zijn voor zorginstellingen die dergelijke activiteiten uitvoeren.

        Iedereen die langdurig nauw contact heeft gehad (binnen 6 voet gedurende ten minste 15 minuten) moet als potentieel blootgesteld worden beschouwd. Het gebruik van een gezichtsmasker voor broncontrole en naleving van andere aanbevolen maatregelen voor infectiepreventie en controle (IPC) (bijv. handhygiëne) door de zorgverlener helpen het risico op overdracht of ernstige ziekte te verminderen. In gebieden met matige tot substantiële overdracht door de gemeenschap lopen patiënten al risico op blootstelling aan SARS-CoV-2 vanwege blootstelling buitenshuis en moeten ze alert zijn op de ontwikkeling van tekenen of symptomen die passen bij COVID-19.

        Het volgende moet in overweging worden genomen bij het bepalen welke patiënten een hoger risico lopen op overdracht en die prioriteit kunnen krijgen bij evaluatie en testen:

          gebruik door de patiënt &ndash In navolging van de richtlijnen voor risicobeoordeling voor zorgpersoneel, lopen patiënten die geen gezichtsmasker dragen waarschijnlijk een hoger risico op infectie in vergelijking met patiënten die een gezichtsmasker dragen.
      • Type interactie dat plaatsvond tussen de patiënt en de geïnfecteerde zorgverlener Een interactie waarbij sprake is van manipulatie of langdurig nauw contact met de ogen, neus of mond van de patiënt (bijv. Tandreiniging) brengt waarschijnlijk een hoger risico op overdracht naar de patiënt met zich mee in vergelijking met andere interacties (bijv. , bloeddrukcontrole).
      • PBM gebruikt door geïnfecteerde zorgverleners & ndash zorgverleners die een gezichtsmasker (of gasmasker) dragen en een gezichtsscherm dat tot onder de kin reikt, hadden mogelijk een betere broncontrole gehad dan het dragen van alleen een gezichtsmasker. Houd er rekening mee dat ademhalingstoestellen met uitademventielen mogelijk geen broncontrole bieden.
      • Huidige status van de patiënt &ndash Is de patiënt momenteel opgenomen in een ziekenhuis of instelling voor langdurige zorg? Deze personen kunnen, indien geïnfecteerd, een hoger risico lopen op een ernstige ziekte en hebben het potentieel om grote aantallen personen bloot te stellen die risico lopen op een ernstige ziekte.
      • 1. Als beroepsbeoefenaren in de gezondheidszorg zijn hersteld van een SARS-CoV-2-infectie, maar binnen 3 maanden na hun eerste infectie een hoog risico hebben op blootstelling aan een patiënt met een SARS-CoV-2-infectie, mogen ze gedurende 14 dagen na de blootstelling van hun werk worden uitgesloten ?

        CDC heeft tussentijdse richtlijnen gepubliceerd voor risicobeoordeling en werkbeperkingen voor zorgverleners met mogelijke blootstelling aan SARS-CoV-2. Vanwege hun vaak uitgebreide en nauwe contact met mensen met een hoog risico op ernstige ziekte, beveelt deze richtlijn een conservatieve benadering aan van het monitoren van de zorgverlener en het toepassen van werkbeperkingen om overdracht van potentieel besmettelijke zorgverleners naar patiënten, andere zorgverleners en bezoekers te voorkomen. Beoordeling van het momenteel beschikbare bewijs suggereert dat de meeste mensen niet opnieuw geïnfecteerd raken in de 3 maanden na SARS-CoV-2-infectie. Het testen van asymptomatische mensen tijdens deze periode van 3 maanden wordt bemoeilijkt door het feit dat sommige mensen een detecteerbaar virus hebben van hun eerdere infectie tijdens deze periode. Een positieve test tijdens deze periode kan eerder het gevolg zijn van een eerdere infectie dan van een nieuwe infectie die een risico vormt voor transmissie.

        In het licht hiervan zouden blootgestelde beroepsbeoefenaren in de gezondheidszorg die zich binnen 3 maanden na hun eerste infectie bevinden, kunnen blijven werken, terwijl ze worden gecontroleerd op symptomen die overeenkomen met COVID-19 en alle aanbevolen praktijken voor infectiepreventie en -bestrijding volgen (bijv. universeel gebruik van goed passende bron controle). Als zich symptomen ontwikkelen, moet de blootgestelde zorgverlener worden beoordeeld en mogelijk getest op SARS-CoV-2, als er geen alternatieve etiologie is vastgesteld. Sommige instellingen kunnen er nog steeds voor kiezen om arbeidsbeperkingen in te stellen voor asymptomatische beroepsbeoefenaren na blootstelling aan een hoger risico, vooral als er onzekerheid bestaat over een eerdere infectie of de duurzaamheid van de immuunrespons van de persoon. Voorbeelden kunnen zijn:

        • HCP met onderliggende immuuncompromitterende aandoeningen (bijv. na orgaantransplantatie) of die immuungecompromitteerd raken (bijv. chemotherapie krijgen) in de 3 maanden na SARS-Cov-2-infectie en die mogelijk een verhoogd risico lopen op herinfectie. Er zijn echter geen gegevens beschikbaar over welke specifieke omstandigheden tot een hoger risico kunnen leiden en over de omvang van het risico.
        • HCP voor wie er bezorgdheid bestaat dat hun initiële diagnose van SARS-CoV-2-infectie gebaseerd zou kunnen zijn op een vals-positief testresultaat (bijv. individu was asymptomatisch, antigeentest positief en een bevestigende nucleïnezuuramplificatietest (NAAT) was niet uitgevoerd).
        • HCP voor wie er aanwijzingen zijn dat ze zijn blootgesteld aan een nieuwe SARS-CoV-2-variant waarvoor het risico op herinfectie mogelijk hoger is (bijv. blootstelling aan een persoon waarvan bekend is dat deze is geïnfecteerd met een nieuwe variant).

        CDC blijft actief onderzoek doen naar de frequentie van herinfectie en de omstandigheden rond deze afleveringen, inclusief de rol die nieuwe varianten kunnen spelen bij herinfectie, en zal de begeleiding indien nodig aanpassen naarmate er meer informatie beschikbaar komt.

        2. Als zorgverleners binnen 3 maanden na hun eerste infectie symptomen ontwikkelen die overeenkomen met COVID-19, moeten ze dan van het werk worden uitgesloten en opnieuw worden getest?

        Professionele zorgverleners binnen 3 maanden na een bevestigde SARS-CoV-2-infectie die symptomen ontwikkelen die overeenkomen met COVID-19, moeten worden geëvalueerd om mogelijke alternatieve etiologieën voor hun symptomen te identificeren. Als er geen alternatieve etiologie voor de symptomen kan worden vastgesteld, moeten ze mogelijk opnieuw worden getest op SARS-CoV-2-infectie, met dien verstande dat een positieve virale test resterende virale deeltjes van de vorige infectie kan vertegenwoordigen, in plaats van een nieuwe infectie. Beslissingen over de noodzaak en duur van werkuitsluiting moeten gebaseerd zijn op de vermoedelijke diagnose (bijv. griep, SARS-CoV-2-infectie).

        3. Moeten zorgverleners binnen 3 maanden na hun eerste infectie alle aanbevolen persoonlijke beschermingsmiddelen (PBM) dragen bij de zorg voor patiënten met een vermoedelijke of bevestigde SARS-CoV-2-infectie? Als er bijvoorbeeld beperkte ademhalingstoestellen zijn, moeten ademhalingstoestellen dan prioriteit krijgen voor zorgverleners die niet eerder zijn geïnfecteerd?

        Ongeacht de vermoede of bevestigde immuniteit, moet zorgpersoneel altijd alle aanbevolen persoonlijke beschermingsmiddelen dragen bij de zorg voor patiënten. In situaties van PBM-tekorten moeten faciliteiten verwijzen naar CDC-strategieën voor het optimaliseren van de PBM-voorziening. Net als bij andere infectieziekten (bijv. mazelen), mag de toewijzing van beschikbare PBM echter niet worden gebaseerd op de vraag of zorgverleners eerder zijn geïnfecteerd of bewijs van immuniteit hebben.

        4. Moeten zorgverleners binnen 3 maanden na hun eerste infectie bij voorkeur worden toegewezen aan de zorg voor patiënten met een vermoedelijke of bevestigde SARS-CoV-2-infectie?

        Hoewel personen die hersteld zijn van een SARS-CoV-2-infectie enige beschermende immuniteit kunnen ontwikkelen, is de duur en omvang van een dergelijke immuniteit niet bekend. Personeelsbeslissingen moeten gebaseerd zijn op de gebruikelijke praktijken van de faciliteit. Elke beroepsbeoefenaar die is toegewezen aan de zorg voor patiënten met een vermoedelijke of bevestigde SARS-CoV-2-infectie, ongeacht de voorgeschiedenis van infectie, moet alle aanbevolen procedures voor infectiepreventie en -bestrijding volgen bij het verlenen van zorg. Ook is er begeleiding beschikbaar om personeelstekorten op te lossen.

        Ja. Professionele zorgverleners die enige vorm van blootstelling hebben waarvoor thuisquarantaine wordt aanbevolen, moeten van het werk worden uitgesloten:

        • Als HCP zijn in staat zijn om buiten de besmette persoon die bij hen woont in quarantaine te gaan, moeten ze thuis in quarantaine gaan en 14 dagen na hun laatste blootstelling aan de geïnfecteerde persoon niet op het werk komen.
        • Als zorgverleners zijn niet in staat zijn om buiten de besmette persoon die bij hen woont in quarantaine te gaan en aanhoudende onbeschermde blootstelling te hebben tijdens de duur van de ziekte van de persoon, moeten ze in thuisquarantaine blijven en tot 14 dagen worden uitgesloten van het werk na de besmette persoon voldoet aan de criteria voor het stopzetten van thuisisolatie.
        • Als zorgverleners een SARS-CoV-2-infectie ontwikkelen terwijl ze in quarantaine zijn, moeten ze van het werk worden uitgesloten totdat ze voldoen aan alle criteria voor terugkeer naar het werk voor zorgverleners met een SARS-CoV-2-infectie.

        Thuisquarantaine en uitsluiting op het werk van asymptomatisch blootgestelde zorgverleners die in de voorgaande 3 maanden zijn hersteld van een SARS-CoV-2-infectie, zijn mogelijk niet nodig. Aanvullende informatie over dit scenario is hier beschikbaar.

        Wanneer bevestigende tests worden uitgevoerd op een persoon met een mogelijk vals-positief antigeentestresultaat, moeten IPC-maatregelen worden gehandhaafd in afwachting van het resultaat. Aanvullende tests van nauwe contacten kunnen worden uitgesteld totdat de resultaten van bevestigende tests beschikbaar zijn, tenzij symptomatische personen worden geïdentificeerd.

        • Voor asymptomatisch zorgpersoneel (HCP) omvat dit voortdurende uitsluiting van werk in afwachting van bevestigende tests.
        • Voor asymptomatische patiënten of bewoners omvat dit plaatsing op transmissiegebaseerde voorzorgsmaatregelen in een eenpersoonskamer of, als er geen eenpersoonskamers beschikbaar zijn, in hun huidige kamer blijven in afwachting van de resultaten van bevestigende tests. Ze mogen niet worden overgebracht naar een COVID-19-eenheid of in een andere gedeelde kamer met nieuwe huisgenoten worden geplaatst.

        Gezien de over het algemeen lagere gevoeligheid van antigeentests, moeten mensen met COVID-19-achtige symptomen die een negatief antigeentestresultaat hebben, in de meeste situaties een bevestigende nucleïnezuuramplificatietest (NAAT) ondergaan, zoals reverse transcriptase-polymerasekettingreactie (RT-PCR). . In afwachting van de resultaten van bevestigende tests, handhaaf de volgende IPC-maatregelen:

        • Patiënten en bewoners met COVID-19-achtige symptomen moeten op transmissie gebaseerde voorzorgsmaatregelen in een eenpersoonskamer worden geplaatst (niet op de COVID-19-eenheid)
        • Professionele zorgverleners met COVID-19-achtige symptomen moeten van het werk worden uitgesloten totdat de bevestigende testresultaten beschikbaar zijn.

        Ondanks de mogelijke behoefte aan bevestigende testen van negatieve resultaten, heeft het aanvankelijke gebruik van antigeentests voor symptomatische mensen nog steeds de voorkeur als de doorlooptijd voor een NAAT >2 dagen is, omdat een positieve antigeentest contactopsporing en implementatie van IPC-maatregelen zou initiëren.

        CDC heeft verschillende manieren aanbevolen om de pasvorm en filtratie van maskers te verbeteren, waaronder het bedekken van een medisch gezichtsmasker met een stoffen masker. Gelaagde maskers vereisen echter speciale zorg in zorginstellingen.

        • Hoewel een stoffen masker over een medisch gezichtsmasker kan worden gebruikt om de pasvorm te verbeteren, kunnen er betere alternatieven zijn, zoals ingelijste &ldquofitters&rdquo of het gebruik van een knoop-en-plooi-benadering om een ​​goede pasvorm te bereiken. Als een goede pasvorm wordt bereikt met een enkel medisch gezichtsmasker, zijn aanvullende benaderingen, zoals het toevoegen van lagen om een ​​betere pasvorm te krijgen, misschien niet nodig.
        • Stoffen mondkapjes zijn geen persoonlijke beschermingsmiddelen (PBM). Ze mogen niet worden gebruikt in plaats van medische gezichtsmaskers of door NIOSH goedgekeurde ademhalingstoestellen als onderdeel van standaard of op transmissie gebaseerde voorzorgsmaatregelen.
        • Het dragen van een medisch gezichtsmasker of stoffen masker over een N95-ademhalingsapparaat wordt niet aanbevolen voor medisch personeel in zorginstellingen, behalve als nood- of crisisstrategie tijdens langdurig gebruik van N95-ademhalingstoestellen om het masker te beschermen tegen contaminatie tijdens aërosolgenererende procedures of procedures die spatten kunnen veroorzaken en sprays.
        • Het dragen van een medisch gezichtsmasker of stoffen masker onder een N95-ademhalingsapparaat wordt nooit aanbevolen, omdat dit de afdichting verstoort.

        In zorginstellingen worden medische gezichtsmaskers door zorgpersoneel gebruikt voor twee algemene doeleinden.

        • Ten eerste als persoonlijke beschermingsmiddelen om de neus en mond van een gezondheidswerker te beschermen tegen blootstelling aan spatten, sprays, spatten en ademhalingsafscheidingen, zoals bij de behandeling van patiënten met druppelvoorzorgsmaatregelen. Bij gebruik als PBM moeten medische gezichtsmaskers na elke ontmoeting met een patiënt worden verwijderd en weggegooid, tenzij langdurig gebruik wordt toegepast als onderdeel van een crisis- of noodcapaciteitsstrategie.
          • Als een stoffen masker over het medische gezichtsmasker wordt gebruikt, moet dit na elke ontmoeting met de patiënt worden verwijderd en gewassen.
          • Stoffen maskers zijn geen persoonlijke beschermingsmiddelen en mogen niet alleen worden gebruikt om te beschermen tegen spatten en sprays, zoals wanneer ze worden gebruikt bij de behandeling van patiënten met druppelvoorzorgsmaatregelen.

          Eenmaal opgezet, mag zorgpersoneel hun medische gezichtsmasker of stoffen masker niet aanraken. Als ze hun medische gezichtsmasker of stoffen masker aanraken of aanpassen, moeten ze voor en na het contact handhygiëne toepassen.

          Als wassen met de hierboven beschreven tussenpozen niet kan worden uitgevoerd, mogen stoffen maskers niet worden gebruikt door medisch personeel in zorginstellingen.

          *Medische gezichtsmaskers zijn persoonlijke beschermingsmiddelen (PBM) en worden vaak chirurgische maskers of proceduremaskers genoemd. Gebruik gezichtsmaskers volgens productetikettering en lokale, provinciale en federale vereisten. Door de FDA goedgekeurde chirurgische maskers zijn ontworpen om te beschermen tegen spatten en sprays en hebben prioriteit voor gebruik wanneer dergelijke blootstellingen worden verwacht, inclusief chirurgische procedures. Gezichtsmaskers die niet door de FDA worden gereguleerd, zoals sommige proceduremaskers, die doorgaans worden gebruikt voor isolatiedoeleinden, bieden mogelijk geen bescherming tegen spatten en sprays.


          Dankbetuigingen

          We danken Daniel Sdicus voor hulp bij donkerveldmicroscopie en voorlopige experimenten, evenals Dr. David M. Ojcius voor het verstrekken van enkele van de bacteriecontroles die in deze studie worden gebruikt. We waarderen ook de hulp van Dr. Tsui-Yin Wong tijdens deze studie. Het werk van de auteurs wordt ondersteund door het Primordia Institute of New Sciences and Medicine met subsidies van Chang Gung Medical Research Projects (CLRPD1A0011, CLRPD1C0011-3 en QZRPD88E), Ming Chi University of Technology (0XB0), het ministerie van Onderwijs van Taiwan (EMRPD1B047 ), en de National Science Council van Taiwan (101-2632-B-182-001-MY3).


          Nieuw inzicht in selectieve bindingseigenschappen van infectieus hiv

          Vrij besmettelijk HIV-1 wordt algemeen beschouwd als de belangrijkste vorm van het virus in het bloed van geïnfecteerde personen. Onderzoekers van het Amerikaanse militaire HIV-onderzoeksprogramma (MHRP) hebben echter aangetoond dat in wezen alle infectieuze virusdeeltjes kunnen binden aan het oppervlak van rode bloedcellen die zijn geïsoleerd van elk van 30 normale (niet-geïnfecteerde) menselijke donoren.

          De resultaten zijn op 15 december gepubliceerd in PLoS Een. De hoofdonderzoekers, Dr. Zoltan Beck en Dr. Carl Alving, onderzoekers met MHRP in de Division of Retrovirology, Walter Reed Army Institute of Research (WRAIR), leggen uit dat de gegevens aantonen dat hoewel infectieuze HIV-1-virusdeeltjes die binden aan rode bloedcellen bevatten slechts een kleine hoeveelheid, misschien wel gemiddeld 2,3% van een typisch HIV-1-preparaat, erytrocytgebonden HIV-1 is dan ongeveer 100 keer besmettelijker dan vrij (niet-celgebonden) HIV- 1 voor infectie van doelcellen.

          De studie concludeert dat infectieuze virionen slechts een kleine fractie vormen van een typisch HIV-1-preparaat en dat in een laboratoriumomgeving alle infectieuze virions zich kunnen binden aan rode bloedcellen en andere niet-permissieve cellen (dwz cellen die niet kunnen worden besmet). Als dit waar is bij met hiv geïnfecteerde mensen, zou dit kunnen betekenen dat aan rode bloedcellen gebonden hiv-1 belangrijker is dan het vrije virus voor de overdracht van infectieus hiv-1 naar doelcellen die geïnfecteerd kunnen zijn.

          Dr. Alving zegt: "Als hetzelfde gedrag van binding van infectieus HIV-1 aan rode bloedcellen optreedt bij mensen, is het mogelijk dat aan rode bloedcellen gebonden infectieuze virionen worden beschermd tegen afbraak of immuunaanvallen."

          Dr. Beck voegt toe: "Deze studie suggereert dat erytrocyten kunnen dienen als een belangrijk, en misschien verborgen, reservoir voor infectieuze HIV-1-virions."


          Detectie van Streptococcus mutans Genomisch DNA in menselijke DNA-monsters geëxtraheerd uit speeksel en bloed

          Cariës is een multifactoriële ziekte, en studies die gericht zijn op het ontrafelen van de factoren die de etiologie moduleren, moeten rekening houden met alle bekende predisponerende factoren. Een belangrijke factor is bacteriële kolonisatie, en Streptococcus mutans is het belangrijkste micro-organisme dat in verband wordt gebracht met het ontstaan ​​van de ziekte. In onze onderzoeken hebben we toegang tot DNA-monsters die zijn geëxtraheerd uit menselijk speeksel en bloed. In dit rapport hebben we een realtime PCR-assay getest die is ontwikkeld om kopieën van genomisch DNA van Streptococcus mutans in 1.424 DNA-monsters van mensen.Onze resultaten suggereren dat we de aanwezigheid van genomische DNA-kopieën van kunnen bepalen Streptococcus mutans in zowel DNA-monsters van cariësvrije als door cariës aangetaste individuen. We waren echter niet in staat om de aanwezigheid van genomische DNA-kopieën van Streptococcus mutans in DNA-monsters die zijn geëxtraheerd uit perifeer bloed, wat suggereert dat de test mogelijk niet gevoelig genoeg is voor dit doel. Waarden van de drempelcyclus van de real-time PCR-reactie correleren met hogere niveaus van cariës-ervaring bij kinderen, maar deze correlatie kon niet worden gedetecteerd voor volwassenen.

          1. Inleiding

          Cariës blijft de meest voorkomende niet-besmettelijke infectieziekte ter wereld [1] en genetische gevoeligheid voor de ziekte is de focus geworden van sommige onderzoeksgroepen die nieuwe strategieën willen bieden om het probleem aan te pakken. Veldstudies zijn enorm vergemakkelijkt door de ontwikkeling van benaderingen waarmee DNA kan worden verkregen uit speekselmonsters [2]. Deze monsters kunnen vervolgens enkele dagen tot maanden bij kamertemperatuur worden bewaard totdat extracties in het laboratorium kunnen plaatsvinden. Een van de uitdagingen van dit werk is dat genetische gevoeligheid voor cariës kan worden gemaskeerd door de omgevingsinvloeden van deze ziekte, zoals microbiële infectie, soorten voeding en blootstelling aan fluoriden.

          Met betrekking tot microbiële kolonisatie, Streptococcus mutans is de belangrijkste soort die betrokken is bij het ontstaan ​​van de ziekte [beoordeeld door [3]]. Bijgevolg is een mogelijkheid dat individuele vatbaarheid voor kolonisatie door Streptococcus mutans toekomstige cariës-ervaring zal beïnvloeden. Echter, de traditionele kwantificering van Streptococcus mutans met mitis-salivarius-bacitracine-agarmedium [4] is arbeidsintensief en vereist directe kweek van plaquemonsters. Een op PCR gebaseerde methode voor targeting gtf (glucosyltransferase) genen van Streptococcus mutans werd ontwikkeld als een alternatieve manier om de bacteriële infectie bij mensen te kwantificeren [5] die nuttig is als een praktisch diagnosesysteem van Streptococcus mutans infectie.

          Dit werk had twee hoofddoelen. Omdat we toegang hebben tot menselijke DNA-monsters uit speeksel, bevatten deze monsters in theorie ook genomische kopieën van de orale microbiële kolonisatie van proefpersonen op de dag van monsterafname. Daarom hebben we de op PCR gebaseerde methode gebruikt voor het detecteren van gtf genen van Streptococcus mutans als de manier om te bepalen of proefpersonen werden gekoloniseerd door Streptococcus mutans en om te testen hoe deze gegevens correleren met cariës-ervaring. De informatie zou vervolgens onze toekomstige genetica-onderzoeken kunnen helpen en de opname van Streptococcus mutans kolonisatie als covariaat in de analyse. Het tweede doel was het detecteren van genomische DNA-kopieën van Streptococcus mutans in menselijke DNA-monsters die uit bloed zijn geëxtraheerd. Sinds Streptococcus mutans kan worden gedetecteerd in hartklep- en atheromateuze plaquemonsters [6, 7], we veronderstellen dat het ook in de bloedsomloop kan worden gedetecteerd. We hebben menselijke DNA-monsters bestudeerd die zijn geëxtraheerd uit perifeer bloed om te testen of genomische DNA-kopieën van Streptococcus mutans kan worden gedetecteerd door de PCR-gebaseerde methode ontwikkeld door Yano et al. [5].

          2. Materiaal en methoden

          2.1. Menselijke DNA-monsters

          Alle monsters die in deze studie werden geëvalueerd, werden verkregen na goedkeuring door de Institutional Review Boards van de Universiteit van Pittsburgh, de Universiteit van Istanbul, CEMIC (Argentinië) en CONEP (Brazilië) en van elk onderwerp werd schriftelijke geïnformeerde toestemming verkregen. In dit onderzoek zijn in totaal 1.424 DNA-monsters opgenomen en deze waren beschikbaar uit een aantal datasets.

          (1) Van de University of Pittsburgh School of Dental Medicine Dental Registry and DNA Repository (DRDR), werden 666 DNA-monsters geëxtraheerd uit volledig speeksel. Deze monsters zijn van goedgekeurde personen uit Pittsburgh en omliggende regio's met een leeftijd variërend van 4 tot 89 jaar (gemiddeld 42,9 jaar). Individuen die deel uitmaken van het register komen overeen met de demografische verdeling van de stad Pittsburgh (ongeveer 70% blank, 20% Afro-Amerikaans en de overige andere groepen). Ongeveer 60% van de proefpersonen is vrouw. De meeste mensen komen uit een lagere sociaaleconomische laag, op basis van hun verzekerbaarheid.

          (2) Van het Center for Oral Health Disparities in Appalachia (COHRA) werden 174 DNA-monsters geëxtraheerd uit volbloed en 44 uit speeksel gebruikt. Deze monsters waren afkomstig van goedgekeurde families die waren gerekruteerd in verschillende locaties op het platteland van Pennsylvania en West Virginia. De DNA-monsters van volbloed waren van personen met een leeftijd variërend van 1 tot 68 jaar (gemiddeld 23,2 jaar) en de DNA-monsters van speeksel waren van kinderen in de leeftijd van 1 tot 11 jaar (gemiddeld 3,3 jaar). Deze onderzoekspopulatie omvat een reeks sociaaleconomische status (mediaan jaarlijks gezinsinkomen minder dan $ 25.000), en is redelijk representatief voor de algemene bevolking van de Appalachen, die erg laag scoort in vergelijking met de rest van de natie in termen van veel mondgezondheidsmaatregelen en toegang tot mondgezondheid zorg. Alle personen in deze analyse waren blank met een verhouding man:vrouw van bijna 1,0.

          (3) Uit Istanbul werden 175 DNA-monsters gebruikt die uit heel speeksel waren geëxtraheerd. Deze monsters zijn afkomstig van kinderen van wie de ouders toestemming hebben gegeven voor deelname aan het onderzoek. Deze kinderen waren 5 tot 6 jaar oud en 85 waren cariësvrij. Deze personen werden gerekruteerd in de Pedodontics Clinics van de Universiteit van Istanbul en kinderdagverblijven in de stad Istanbul. Negenenzeventig waren mannen en 94 vrouwen.

          (4) Uit Pittsburgh werden ook 158 DNA-monsters gebruikt die waren geëxtraheerd uit heel speeksel en die niet overlapten met de monsters van de Dental Registry en DNA Repository. Deze monsters waren afkomstig van personen met toestemming die werden geëvalueerd als een vereiste voor studenten van de University of Pittsburgh School of Dental Medicine die de cursus cariologie volgden. Deze personen hebben een leeftijd variërend van 13 tot 82 jaar (gemiddeld 43,3 jaar) en hun kenmerken lijken sterk op de kenmerken die hierboven zijn beschreven voor de DRDR-steekproef.

          (5) Uit Guatemala werden 109 DNA-monsters gebruikt die uit heel speeksel waren geëxtraheerd. Deze monsters zijn van goedgekeurde gezinnen met kinderen geboren met mondspleten en controles die zorg kregen tijdens een medische missie gesponsord door de non-profitorganisatie Children of the Americas. Deze steekproeven zijn van personen met een leeftijd variërend van 14 tot 60 jaar (gemiddeld 28 jaar). Vijfenveertig waren mannen en 64 vrouwen. Monsters van personen geboren met kloven werden niet opgenomen in de huidige studie, omdat er een suggestie is dat deze personen een hogere incidentie van cariës hebben.

          (6) Uit Argentinië werden 98 DNA-monsters gebruikt die uit heel speeksel waren geëxtraheerd. Deze monsters zijn afkomstig van goedgekeurde gezinnen met kinderen geboren met mondspleten die in de regio Patagonië wonen, van personen met een leeftijd variërend van 10 tot 72 jaar (gemiddeld 31,5 jaar). Monsters van personen geboren met kloven werden niet opgenomen omdat er een suggestie is dat deze personen een hogere incidentie van cariës kunnen hebben. Deze onderzoekspopulatie is in feite het mengsel van Indiaanse Mapuches en Spanjaarden en komt uit een lagere sociaaleconomische laag. De verhouding man:vrouw is bijna 1,0.

          DMFT/dmft-scores (vervallen, ontbrekend door cariës, gevulde tanden) waren beschikbaar voor alle DNA-monsters die in dit onderzoek werden gebruikt en werden verkregen zoals aanbevolen door de Wereldgezondheidsorganisatie [1]. Ze werden verzameld volgens internationale normen. Een hogere verhouding van actieve carieuze laesies werd gezien bij jongere proefpersonen. Voor de 174 DNA-monsters geëxtraheerd uit volbloed, semi-kwantitatieve waarden van Streptococcus mutans waren ook beschikbaar (beoordeeld uit speeksel van dezelfde proefpersonen met Dentocult SM Strip-mutans, Orion Diagnostica Oy, P.O.Box 83, Espoo, Finland). Alle 1 424 DNA-monsters werden eerder met succes getest in andere op PCR gebaseerde benaderingen voor genotypering.

          2.2. DNA-extractie

          DNA werd geëxtraheerd uit speekselmonsters met behulp van het protocol van de fabrikant voor handmatige zuivering van DNA uit 4,0 ml, PD-PR-015 uitgave 2.0. Speekselmonsters waren eerder tot 3 maanden bij kamertemperatuur bewaard in de Oragene-flesjes tot DNA-extractie. Volgens de fabrikant van de flacons is speeksel-DNA bij kamertemperatuur ruim 2 jaar stabiel [8]. Het gehele speekselmonster werd geëxtraheerd met reagensvolumes die waren aangepast om de hoeveelheid teruggewonnen DNA te maximaliseren. In het kort werden monsters gemengd door inversie en vervolgens overnacht bij 50°C geïncubeerd. Monsters werden overgebracht naar een centrifugebuis en gemengd met Oragene-zuiveraar, op ijs geïncubeerd en vervolgens gedurende 20 minuten bij 3000 x g gecentrifugeerd om het gedenatureerde eiwit te pelleteren. Het supernatant werd overgebracht naar een nieuwe buis en DNA werd geprecipiteerd door een gelijk volume 100% ethanol toe te voegen. De DNA-pellet werd gewassen met 70% ethanol, gedroogd en opnieuw gesuspendeerd met TE-buffer. DNA werd 1 uur bij 50°C geïncubeerd, gevolgd door een nacht bij kamertemperatuur incuberen om volledige rehydratatie te verzekeren. Een snelle centrifugatiestap bij 15.000 x g werd uitgevoerd om extra onzuiverheden te verwijderen.

          DNA werd geëxtraheerd uit bloedmonsters met behulp van de QIAamp DNA Mini Kit volgens de instructies van de fabrikant.

          2.3. Realtime PCR-test

          De test was gebaseerd op het experiment ontwikkeld door Yano et al. [5]. In dat werk werd DNA geëxtraheerd uit heel speeksel van menselijke proefpersonen. Yano et al. [5] valideerde deze methode met de standaardcultuurbenadering als parameter. Ze meldden dat deze testresultaten met betrekking tot het meten Streptococcus mutans zijn sterk gecorreleerd met de resultaten verkregen uit kweek. Bovendien is de gevoeligheid van beide methoden zeer vergelijkbaar, waarbij de real-time PCR in staat is om de aanwezigheid van ongeveer 800 kopieën van genomisch DNA van Streptococcus mutans. De test maakt echter geen onderscheid tussen de specifieke Streptococcus mutans serotypen c, e of f. Primers die in de test worden gebruikt, hybridiseren met geconserveerde regio's van gtfB en gtfC-genen van Streptococcus mutansen amplificeer 415 basenpaar DNA-fragmenten van beide genen.

          Real-time PCR werd uitgevoerd met behulp van het ABI PRISM 7900HT Fast Real-Time PCR-systeem (Applied Biosystems). Elke reageerbuis bevatte 10 μL reactiemengsel, inclusief 1 X SYBR Green PCR-buffer, 0,025 U/uL AmpliTaqGold DNA-polymerase, 0,01 U/uL AmpErase UNG (uracil N-glycosylase), 1,2 mM van elk van de dNTP's, 3 mM MgCL2 (SYBR Green PCR-kernreagentia, Applied Biosystems), 2 μL humaan DNA geëxtraheerd uit speeksel- of bloedmonsters en 0,8 mM van elke primer specifiek voor Streptococcus mutans (vooruit 5′AGCCATGCGCAATCAACAGGTT3′ en achteruit 5′CGCAACGCGAAACATCTTGATCAG3′). De specificiteit van deze primers werd eerder getest [5] en Streptococcus mutans genomisch DNA (Streptococcus mutans ATCC 25175) werd in alle reacties opgenomen als positieve controle en er werden standaard DNA-curven gegenereerd. De fietsomstandigheden waren 2 minuten bij 50°C voor uracil N-glycosylase (deze behandeling voorkomt overdracht van kruisbesmetting door uracil-bevattende fragmenten te verteren die voorafgaand aan de PCR-test zijn gegenereerd), 10 minuten bij 95°C voor activering van AmpliTaqGold, 40 cycli van 15 seconden bij 95°C voor denaturatie en 1 minuut bij 68°C voor gloeien en verlengen. Waarden van de drempelcyclus (Ct) boven nul werden als positief beschouwd voor Streptococcus mutans infectie op basis van de succesvolle amplificatie van de doelsequentie. Deze waarden waren gecorreleerd met DMFT-scores en een alfa van 0,05 werd als statistisch significant beschouwd.

          3. Resultaten

          Onze resultaten waren compatibel met de verwachte waarden verkregen uit de validatieprocedures beschreven door Yano et al. [5]. Een subset van monsters werd meerdere keren op verschillende tijdstippen getest en de resultaten kwamen overeen. Streptococcus mutans genomisch DNA werd gedetecteerd in monsters van menselijk speeksel, zowel bij personen zonder cariës als bij personen met eerdere/huidige cariës-ervaring (tabel 1). Genomisch DNA kopieert echter van Streptococus mutans kon niet worden gedetecteerd in DNA-monsters van humaan perifeer bloed (tabel 2). Deze monsters werden verkregen van zowel volwassenen als kinderen met verschillende niveaus van cariës-ervaring (tabel 3). Wanneer DMFT/dmft-scores werden gecorreleerd met de waarden van de drempelcycli van het real-time PCR-experiment, werden statistisch significante correlaties alleen gevonden in de groepen die uitsluitend uit monsters van kinderen bestonden (tabel 2). Het stratificeren van de gegevensanalyse van de volwassen monsters naar leeftijd veranderde de resultaten niet wezenlijk.

          DMFT/dmft gemiddelders statistiekent statistiekenGraden van vrijheid*tweestaartig

          4. Discussie

          Elke studie met betrekking tot de etiologie van cariës moet rekening houden met de multifactoriële aard van de ziekte. Microbiële kolonisatie is een belangrijke factor die het begin van de ziekte moduleert en er moet altijd rekening mee worden gehouden. In het geval van onze onderzoeken, waarin we DNA-monsters hebben die zijn geëxtraheerd uit menselijk speeksel, is de realtime PCR-test ontwikkeld door Yano et al. [5] om de aanwezigheid van genomische DNA-kopieën van te identificeren Streptococcus mutans in het monster kan worden gebruikt als een indicatie van de aanwezigheid van zijn kolonisatie.

          We hebben de aanwezigheid gedetecteerd van Streptococcus mutans genomische DNA-kopieën in een aantal cariësvrije individuen (tabel 1). Dit resultaat kan op verschillende manieren worden geïnterpreteerd. Streptococcus mutans in het speeksel is noodzakelijk maar niet voldoende om de ziekte en/of de aanwezigheid van carieuze laesies vast te stellen. Het micro-organisme kan aanwezig zijn in cariësvrije individuen, maar hun detecteerbare niveaus zijn lager. Een andere mogelijkheid is dat tot 10% van de cariëslaesies kan worden gemist door het gebruik van de door de Wereldgezondheidsorganisatie aanbevolen methode zonder aanvulling van röntgenfoto's [9].

          Slayton et al. [10] toonde aan dat Streptococcus mutans niveaus waren positief geassocieerd met cariës-ervaring bij kinderen van 3 tot 5 jaar. De auteurs maten niveaus van Streptococcus mutans door microbiologische testen, volgens het protocol beschreven door Edelstein en Tinanoff [11], door een houten tongblad aan te raken op het dorsale oppervlak van de tong totdat het nat is en vervolgens het tongblad te gebruiken om selectief groeimedium te inoculeren voor Streptococcus mutans (CRT Bacteria Kit, IvoclarVivadent, Schaan, Liechtenstein). Ook werd een significante interactie gesuggereerd tussen genetische variatie in tuftelin, een gen waarvan wordt gesuggereerd dat het betrokken is bij de vorming van glazuur, en niveaus van Streptococcus mutans. Voorheen waren we niet in staat om de resultaten van een mogelijke interactie tussen variatie in tuftelin en niveaus van Streptococcus mutans [12]. We gebruikten dezelfde real-time PCR-assay die hier is beschreven om de aanwezigheid of afwezigheid van te definiëren Streptococcus mutans kolonisatie in het onderzoek. Onze huidige analyse bevestigt echter: Streptococcus mutans niveaus worden geassocieerd met cariës-ervaring bij kinderen, wat de bevindingen van Slayton et al. bevestigt. [10]. Onze resultaten laten duidelijk zien dat DMFT-scores van volwassenen niet correleren met Streptococcus mutans kolonisatie gemeten door real-time PCR-assays. De waarschijnlijke reden is dat Streptococcus mutans worden geassocieerd met het begin van de ziekte, die meestal kinderen treft, en cariës-ervaringsscores (dmft) zijn meestal gerelateerd aan de aanwezigheid van rotte tanden. Bij volwassenen worden de DMFT-scores ook beïnvloed door het aantal ontbrekende en opgevulde tanden als gevolg van cariës en hoewel de DMFT-score bij alle personen de neiging heeft om in de loop van de tijd toe te nemen, is de mate van Streptococcus mutans wordt het meest verhoogd in gevallen waar zich nieuwe carieuze laesies in het glazuur ontwikkelen. Streptococcus mutans tellingen correleren ook met suikerinname en men kan stellen dat individuele variatie in dieet het verwachte aantal bacteriën wijzigt, hoewel deze hypothese niet gemakkelijk kan worden getest in een cross-sectioneel onderzoeksontwerp. Hieruit blijkt duidelijk de noodzaak van een diep begrip van de etiopathogenese van cariës bij het voorstellen om genetische vatbaarheid voor de ziekte te bestuderen. Onze studie bevestigt dat bij kinderen niveaus van Streptococcus mutans duidelijk correleren met hogere cariës-ervaring en hogere vatbaarheid voor de ziekte.

          Er is een toenemende belangstelling voor het begrijpen van de mogelijke invloed van mondgezondheid op de systemische gezondheid. Er is gesuggereerd dat hogere cariëspercentages kunnen worden gevonden bij personen met specifieke systemische ziekten zoals hart- en vaatziekten [13], astma en epilepsie [14]. We hebben geen niveaus van kunnen detecteren Streptococcus mutans in de DNA-monsters die zijn geëxtraheerd uit perifeer bloed. Dit kan te wijten zijn aan de methode die wordt gebruikt voor DNA-extractie, die mogelijk slecht herstelt Streptococcus mutans genomisch DNA in het monster of vanwege het lage niveau van Streptococcus mutans in het originele exemplaar. Er is bewijs dat Streptococcus mutans kunnen worden gedetecteerd in hartklep- en atheromateuze plaquemonsters [6, 7] en reizen daarom van de mond naar het hart. De verklaring is waarschijnlijk dat zeer kleine aantallen bacteriekopieën, onder de gevoeligheid van de real-time PCR-test, kunnen worden gevonden in een bepaald volume bloed van een getroffen persoon. Terwijl de concentratie van Streptococcus mutans varieert op basis van de aard van het verzamelde monster (bloed of speeksel) en van de manier waarop het is verzameld (geheel speeksel of gebufferd speeksel), lijken DNA-isolatiemethoden geen belangrijke invloed te hebben op het herstel van genomisch DNA van Streptococcus mutans of de prestaties van deze op PCR gebaseerde test [5]. Er is grote belangstelling voor benaderingen die kunnen helpen voorspellen hoe mondgezondheid de systemische gezondheid kan beïnvloeden en toekomstig werk in ons laboratorium zal erop gericht zijn variabelen te identificeren die kunnen dienen als voorspellers van een slechte systemische gezondheid.

          Onze gegevens bieden een reden voor het focussen van toekomstige genetische studies van cariës in jongere populaties, waarbij niveaus van Streptococcus mutans beter correleren met bestaande metingen van ziekte-ervaring, en de bemonstering heeft de neiging om meer homogeen te zijn.

          Dankbetuigingen

          Geen van de auteurs heeft een directe financiële relatie met enige commerciële identiteit die in dit artikel wordt genoemd, noch heeft zij enig ander belangenconflict te melden. De auteurs zijn veel dank verschuldigd aan alle proefpersonen die enthousiast hebben toegestemd om deel uit te maken van dit project. Melissa Carp herzag de tekst voor grammatica en stijl. Gegevens voor deze studie werden verstrekt door de Dental Registry and DNA Repository van de School of Dental Medicine, University of Pittsburgh. Ze bedanken Children of the Americas, Inc. voor hun steun tijdens het verzamelen van gegevens in Guatemala. N.F. Callahan en ik.Anjomshoaa werden ondersteund door het CTSI START UP-programma, de pre-doctorale prijs op korte termijn via het Clinical and Translational Science Institute en het Institute for Clinical Research Education aan de Universiteit van Pittsburgh (NIH Grant 5TL1RR024155-02). Financiële steun voor dit werk werd verleend door NIH Grants R01-DE018914 (naar AR Vieira), R01-DE014899 (naar ML Marazita, AR Vieira, RJ Weyant, R. Crout, DW McNeil), R01-DE016148 (ML Marazita, AR Vieira , EE Castilla), P50-DE016215 (naar ML Marazita) door de Agencia Nacional de Promoción Científica y Tecnológica (ANPCyT), Argentinië, Grant no.: PICTO-CRUP 2005 no. 31101 door de Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET), Argentinië voor financiële steun van ECLAMC van CNPq (Nationale Onderzoeksraad van Brazilië), proces # 573993/2008-4 INAGEMP. De financiers hadden geen rol bij het ontwerp van de studie, het verzamelen en analyseren van gegevens, de beslissing om te publiceren of de voorbereiding van het artikel.

          Referenties

          1. Wereldgezondheidsorganisatie, "The world oral health report 2003", Tech. Rep., Wereldgezondheidsorganisatie, Genève, Zwitserland, 2003. Bekijken op: Google Scholar
          2. T. Rylander-Rudqvist, N. Håkansson, G. Tybring en A. Wolk, "Kwaliteit en kwantiteit van speeksel-DNA verkregen met de zelf-toegediende oragene-methode - een pilotstudie bij het cohort van Zweedse mannen," Kanker Epidemiologie Biomarkers en preventie, vol. 15, nee. 9, pp. 1742–1745, 2006. Bekijk op: Publisher Site | Google geleerde
          3. J. M. Tanzer, J. Livingston en A. M. Thompson, "De microbiologie van primaire tandcariës bij mensen", Tijdschrift voor tandheelkundig onderwijs, vol. 65, nee. 10, blz. 1028-1037, 2001. Bekijk op: Google Scholar
          4. O. G. Gold, H. V. Jordan en J. Van Houte, "Een selectief medium voor" Streptococcus mutans,” Archieven van orale biologie, vol. 18, nee. 11, blz. 1357-1364, 1973. Bekijk op: Google Scholar
          5. A. Yano, N. Kaneko, H. Ida, T. Yamaguchi en N. Hanada, "Real-time PCR voor kwantificering van Streptococcus mutans,” FEMS Microbiologie Brieven, vol. 217, nee. 1, pp. 23-30, 2002. Bekijk op: Publisher Site | Google geleerde
          6. K. Nakano, H. Inaba, R. Nomura et al., "Detectie van cariogene Streptococcus mutans in uitgestorven hartkleppen en atheromateuze plaque-specimens,” Tijdschrift voor klinische microbiologie, vol. 44, nee. 9, blz. 3313-3317, 2006. Bekijk op: Publisher Site | Google geleerde
          7. K. Nakano, H. Nemoto, R. Nomura et al., "Detectie van orale bacteriën in cardiovasculaire monsters," Orale microbiologie en immunologie, vol. 24, nee. 1, blz. 64-68, 2009. Bekijk op: Publisher Site | Google geleerde
          8. R. M. Iwasiow, A. Desbois en H. C. Birnboim, Langetermijnstabiliteit van DNA van speekselmonsters opgeslagen in Oragene®DNA, DNA Genotek, Ontario, Canada, 2004.
          9. S. F. Mestriner, L. C. Pardini en W. Mestriner, "Impact van de opname van het bijtende radiografie-examen op de prevalentie van tandcariës bij 12-jarige studenten in de stad Franca, São Paulo, Brazilië," Tijdschrift voor Toegepaste Orale Wetenschappen, vol. 14, nee. 3, blz. 167-171, 2006. Bekijken op: Google Scholar
          10. R.L. Slayton, M.E. Cooper en M.L. Marazita, "Tuftelin, mutans streptokokken en tandcariësgevoeligheid," Tijdschrift voor tandheelkundig onderzoek, vol. 84, nee. 8, blz. 711–714, 2005. Bekijk op: Publisher Site | Google geleerde
          11. B. Edelstein en N. Tinanoff, "Voorschoolse kinderen screenen op cariës met behulp van een microbiële test", Kindertandheelkunde, vol. 11, nee. 2, blz. 129-132, 1989. Bekijk op: Google Scholar
          12. K. Deeley, A. Letra, E.K. Rose et al., "Mogelijke associatie van amelogenine met hoge cariës-ervaring in een Guatemalteekse-Maya-populatie," Cariës onderzoek, vol. 42, nee. 1, pp. 8-13, 2008. Bekijk op: Publisher Site | Google geleerde
          13. P. Holm-Pedersen, K. Avlund, D.E. Morse et al., "Cariës, parodontitis en hartritmestoornissen bij thuiswonende ouderen van 80 jaar en ouder: is er een verband?" Tijdschrift van de American Geriatrics Society, vol. 53, nee. 3, pp. 430-437, 2005. Bekijk op: Publisher Site | Google geleerde
          14. I. Anjomshoaa, M.E. Cooper en A.R. Vieira, "Cariës wordt geassocieerd met astma en epilepsie," European Journal of Dental, vol. 3, blz. 297–303, 2009. Bekijken op: Google Scholar

          Auteursrechten

          Copyright © 2011 Alexandre R. Vieira et al. Dit is een open access-artikel dat wordt gedistribueerd onder de Creative Commons Attribution-licentie, die onbeperkt gebruik, distributie en reproductie in elk medium toestaat, op voorwaarde dat het originele werk correct wordt geciteerd.



Opmerkingen:

  1. Thacker

    We vonden iedereen leuk!

  2. Merisar

    Ik kan nu niet deelnemen aan de discussie - er is geen vrije tijd. Ik kom terug - ik zal zeker mijn mening over deze kwestie geven.

  3. Vojas

    Uitzonderlijke waanideeën

  4. Bodgan

    Mijn excuses, maar naar mijn mening begaat u een fout. Ik kan de positie verdedigen. Schrijf me in PM, we zullen het bespreken.

  5. Kerman

    Je hebt ongelijk. Ik stel voor om het te bespreken. E -mail me op PM, we zullen praten.



Schrijf een bericht