Informatie

Zijn er verschillen tussen de activeringseiwitten van Eukaryoten en die van Prokaryoten?

Zijn er verschillen tussen de activeringseiwitten van Eukaryoten en die van Prokaryoten?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Ik zit in BIO 203 (ter verwijzing naar mijn vaardigheidsniveau), en ik merkte dat het leerboek een hele sectie maakt van transcriptionele activator-eiwitten, hun functie en toepassingen in eukaryoten, maar in prokaryoten wordt de term "activator-eiwit" slechts één keer gebruikt bij het noemen van het lac-operon.

Zijn het dezelfde soort activator-eiwitten? Gebruiken ze dezelfde mechanismen?


Over het algemeen zijn transcriptie-activators transcriptiefactoren. Deze zijn heel verschillend bij eukaryoten, hoewel sommige families vergelijkbare domeinen delen (bijvoorbeeld signalisatie met twee componenten). Ik raad u aan deze twee hoofdstukken door te lezen om een ​​vollediger overzicht van de verschillen te krijgen.

https://www.ncbi.nlm.nih.gov/books/NBK21683/

https://www.ncbi.nlm.nih.gov/books/NBK21572/


Vergelijk en contrasteer prokaryotische en eukaryote genexpressie

Prokaryote en eukaryote genexpressie zijn de twee cellulaire processen die verantwoordelijk zijn voor de expressie van genen in het genoom om een ​​functioneel genproduct te produceren. In het algemeen doorlopen beide processen twee stappen: transcriptie en translatie. Dit artikel is bedoeld om prokaryotische en eukaryote genexpressie te vergelijken en te contrasteren.

In prokaryoten zijn de nauw verwante genen geclusterd om operons te vormen en zo een polycistronisch mRNA-molecuul te produceren. Ondertussen ondergaan de functionele genen afzonderlijk expressie en produceren ze dus monocistronische mRNA's. Bovendien vinden transcriptie en translatie gelijktijdig plaats in het cytoplasma van prokaryoten. Maar bij eukaryoten komen ze afzonderlijk voor, de eerste in de kern en de laatste in het cytoplasma. Bovendien ondergaan eukaryoten zowel post-transcriptionele als translationele modificaties.

Belangrijkste gebieden die worden gedekt

Sleutelbegrippen

Eukaryotische genexpressie, mRNA's, prokaryotische genexpressie, vertaling, transcriptie


Verschil tussen eiwitsynthese bij prokaryoten en eukaryoten

Eiwitsynthese heeft zijn stappen op een zeer sterk geordende manier in elke cel van het hele biologische woord, maar er zijn kleine identiteiten in elk. Er zijn echter serieus aanzienlijke verschillen tussen prokaryotische en eukaryote eiwitsyntheseroutes, ondanks dat het eindresultaat in beide gevallen altijd een eiwit is. De componenten van de twee soorten cellen kunnen de belangrijkste reden zijn waarom ze van elkaar verschillen. De belangrijkste stappen van transcriptie, RNA-verwerking en translatie zijn echter hetzelfde in zowel prokaryoten als eukaryoten. Een algemeen overzicht van eiwitsynthese wordt in dit artikel gepresenteerd, gevolgd door gemakkelijk te verteren discussies over de belangrijkste aanzienlijke verschillen tussen elkaar.

Eiwitsynthese

Eiwitsynthese is een biologisch proces dat plaatsvindt in de cellen van organismen in drie hoofdstappen die bekend staan ​​als transcriptie, RNA-verwerking en translatie. In de transcriptiestap wordt de nucleotidesequentie van het gen in de DNA-streng getranscribeerd in RNA. Deze eerste stap lijkt sterk op de DNA-replicatie, behalve dat het resultaat een streng op RNA is bij de eiwitsynthese. De DNA-streng wordt ontmanteld met DNA-helicase-enzym, RNA-polymerase wordt bevestigd op de specifieke plaats van het begin van het gen dat bekend staat als promotor, en RNA-streng wordt langs het gen gesynthetiseerd. Deze nieuw gevormde RNA-streng staat bekend als het boodschapper-RNA (mRNA).

De mRNA-streng brengt de nucleotidesequentie naar de ribosomen voor de RNA-verwerking. Specifieke tRNA (transfer RNA) moleculen zullen de relevante aminozuren in het cytoplasma herkennen. Daarna worden tRNA-moleculen aan de specifieke aminozuren gehecht. In elk tRNA-molecuul is er een reeks van drie nucleotiden. Een ribosoom in het cytoplasma wordt bevestigd aan de mRNA-streng en het startcodon (de promotor) wordt geïdentificeerd. De tRNA-moleculen met de overeenkomstige nucleotiden voor de mRNA-sequentie worden naar de grote subeenheid van het ribosoom verplaatst. Als de tRNA-moleculen naar het ribosoom komen, wordt het overeenkomstige aminozuur via een peptidebinding aan het volgende aminozuur in de reeks gebonden. Deze laatste stap heet inderdaad vertaling, hier vindt de eigenlijke eiwitsynthese plaats.

De vorm van het eiwit wordt bepaald door de verschillende soorten aminozuren in de keten, die aan tRNA-moleculen vastzaten, maar tRNA is specifiek voor de mRNA-sequentie. Het is dus duidelijk dat de eiwitmoleculen de informatie weergeven die is opgeslagen in het DNA-molecuul. Eiwitsynthese zou echter ook kunnen worden gestart vanuit een RNA-streng.

Wat is het verschil tussen eiwitsynthese bij prokaryoten en eukaryoten?

• Terwijl de transcriptiestap plaatsvindt, zijn de ribosomen in staat om te associëren met de vormende mRNA-streng in prokaryoten omdat ze geen nucleaire envelop hebben om de nucleïnezuren te omsluiten. Echter, mRNA kan associëren met de ribosomen nadat de streng in eukaryoten uit de kern is verplaatst.

• Het wordt dus duidelijk dat bij prokaryoten de translatiestap van het proces al is gestart voordat de transcriptie is voltooid, terwijl de twee stappen bij eukaryoten ver uit elkaar plaatsvinden. Met andere woorden, RNA-verwerking vindt niet plaats in prokaryote synthese, maar wel in het eukaryote proces.

• Slechts één gen komt tot expressie in één volledig proces van eiwitsynthese in eukaryoten, terwijl er vaak meerdere genen tot expressie komen in bacteriële (prokaryotische) eiwitsynthese van één mRNA-streng. Met andere woorden, geclusterde genen (bekend als Operons) kunnen tot expressie worden gebracht door prokaryoten, maar niet door eukaryoten.

• Er zijn niet-coderende DNA-sequenties in eukaryote nucleïnezuren die bekend staan ​​als Introns, maar niet in prokaryoten. Het mRNA in eukaryoten verwijdert de introns van zijn streng voordat het de kern verlaat, wat in contrast staat met de eenvoudige vorming van een mRNA-streng in prokaryoten.


Invoering

Membraantransportsystemen spelen een essentiële rol in het cellulaire metabolisme en activiteiten. Transporters werken bij de verwerving van organische voedingsstoffen, het in stand houden van de ionenhomeostase, de extrusie van giftige en afvalverbindingen, omgevingswaarneming en celcommunicatie en andere belangrijke cellulaire functies [1]. Verschillende transportsystemen verschillen in hun vermeende membraantopologie, energiekoppelingsmechanismen en substraatspecificiteiten [2]. Tot de overheersende energiebronnen behoren adenosinetrifosfaat (ATP), fosfoenolpyruvaat en chemiosmotische energie in de vorm van elektrochemische natriumionen of protonen.

Het transporterclassificatiesysteem (//www.tcdb.org/) vertegenwoordigt een systematische benadering om transportsystemen te classificeren op basis van hun transportwijze, energiekoppelingsmechanisme, moleculaire fylogenie en substraatspecificiteit [2-5]. Transportmodus en energiekoppelingsmechanisme dienen als primaire basis voor classificatie vanwege hun relatief stabiele kenmerken. Er zijn vier hoofdklassen van opgeloste stoffentransporteurs in het transporterclassificatiesysteem: kanalen, primaire (actieve) transporters, secundaire transporters en groepstranslocators. Transporters met een onbekend mechanisme of functie worden als een aparte klasse opgenomen. Kanalen zijn energie-onafhankelijke transporters die water, specifieke soorten ionen of hydrofiele kleine moleculen door een concentratie of elektrische gradiënt transporteren. Ze hebben hogere transportsnelheden en lagere stereospecificiteit dan de andere transporterklassen (bijv. Escherichia coli GlpF glycerolkanaal [6]). Primaire actieve transporters (bijv. Lactococcus lactis LmrP multidrug efflux pomp [7]) koppelt het transportproces aan een primaire energiebron (ATP hydrolyse). Secundaire transporters gebruiken een elektrochemische gradiënt van ionen of opgeloste stoffen, bijvoorbeeld een proton/natrium-aandrijfkracht, om het transportproces aan te drijven. E coli LacY lactose permease [8,9] is waarschijnlijk een van de best gekarakteriseerde secundaire transporters [10]. Groepstranslocators wijzigen hun substraten tijdens het transportproces. Bijvoorbeeld, E coli MtlA-mannitol PTS-transporter fosforyleert exogeen mannitol met behulp van fosfoenolpyruvaat als fosforyldonor en energiebron en laat de fosfaatester, mannitol-1-P, vrij in het celcytoplasma [11,12]. Elke transporterklasse wordt verder ingedeeld in individuele families en subfamilies op basis van hun functie, fylogenie en/of substraatspecificiteit [3].

Sinds de komst van genomische sequencing-technologieën zijn tot nu toe de volledige sequenties van meer dan 200 prokaryote en eukaryote genomen gepubliceerd, die een breed scala aan soorten vertegenwoordigen, van archaea tot de mens. Er zijn momenteel ook meer dan 1.100 extra genoomsequencing-projecten gaande over de hele wereld (Gold Genomes Online Database, http://www.genomesonline.org/) [13,14]. Handige en effectieve computationele methoden zijn vereist om de enorme hoeveelheid gegevens te verwerken en te analyseren die worden gegenereerd door de sequencing-projecten van het hele genoom. Een diepgaande blik op transporteiwitten is van vitaal belang voor het begrip van het metabolische vermogen van organismen waarvan de sequentie is bepaald. Het is echter vaak problematisch om deze transporteiwitten te annoteren met de huidige primaire annotatiemethoden vanwege het voorkomen van grote en complexe transportergenfamilies, zoals de ATP-bindende cassette (ABC) superfamilie [15,16] en de grote faciliterende superfamilie ( MFS) [17,18], en de aanwezigheid van meerdere paralogen van transportergenen in veel organismen. We hebben gewerkt aan een systematische genoombrede analyse van cellulaire membraantransportsystemen. Eerder rapporteerden we een uitgebreide analyse van de transportsystemen in 18 prokaryotische organismen [19,20] en in gist [21]. Hier breiden we onze analyses uit tot 141 soorten en vergelijken we de fundamentele verschillen in membraantransportsystemen in prokaryoten en eukaryoten. Fylogenetische profilering van transporterfamilies en voorspelde substraten werd gebruikt om de relevantie van transportmogelijkheden voor de algehele fysiologie van prokaryoten en eukaryoten te onderzoeken.


22.2 Structuur van prokaryoten: bacteriën en archaea

Aan het einde van dit gedeelte kunt u het volgende doen:

  • Beschrijf de basisstructuur van een typische prokaryoot
  • Beschrijf belangrijke verschillen in structuur tussen Archaea en Bacteria

Er zijn veel verschillen tussen prokaryote en eukaryote cellen. De naam "prokaryoten" suggereert dat prokaryoten worden gedefinieerd door uitsluiting - het zijn geen eukaryoten of organismen waarvan de cellen een kern en andere interne membraangebonden organellen bevatten. Alle cellen hebben echter vier gemeenschappelijke structuren: het plasmamembraan, dat fungeert als een barrière voor de cel en de cel scheidt van zijn omgeving het cytoplasma, een complexe oplossing van organische moleculen en zouten in de cel een dubbelstrengs DNA-genoom, het informatiearchief van de cel en ribosomen, waar eiwitsynthese plaatsvindt. Prokaryoten zijn er in verschillende vormen, maar veel vallen in drie categorieën: kokken (bolvormig), bacillen (staafvormig), en spirilli (spiraalvormig) (Figuur 22.9).

De prokaryotische cel

Bedenk dat prokaryoten eencellige organismen zijn die geen membraangebonden organellen of andere interne membraangebonden structuren hebben (Figuur 22.10). Hun chromosoom - meestal enkelvoudig - bestaat uit een stuk circulair, dubbelstrengs DNA dat zich in een gebied van de cel bevindt dat de nucleoïde wordt genoemd. De meeste prokaryoten hebben een celwand buiten het plasmamembraan. De celwand fungeert als een beschermende laag en is verantwoordelijk voor de vorm van het organisme. Sommige bacteriesoorten hebben een capsule buiten de celwand. De capsule stelt het organisme in staat zich aan oppervlakken te hechten, beschermt het tegen uitdroging en aanval door fagocytische cellen, en maakt ziekteverwekkers resistenter tegen onze immuunresponsen. Sommige soorten hebben ook flagella (enkelvoud, flagellum) die wordt gebruikt voor voortbeweging, en pili (enkelvoud, pilus) die wordt gebruikt voor bevestiging aan oppervlakken, inclusief de oppervlakken van andere cellen. Plasmiden, die bestaan ​​uit extra-chromosomaal DNA, zijn ook aanwezig in veel soorten bacteriën en archaea.

Bedenk dat prokaryoten zijn verdeeld in twee verschillende domeinen, Bacteria en Archaea, die samen met Eukarya de drie domeinen van het leven vormen (Figuur 22.11).

Kenmerken van bacteriële phyla worden beschreven in figuur 22.12 en figuur 22.13. Belangrijke bacteriële phyla zijn de Proteobacteria, de Chlamydias, de Spirochaetes, de fotosynthetische Cyanobacteria en de Gram-positieve bacteriën. De Proteobacteriën zijn op hun beurt weer onderverdeeld in verschillende klassen, van de Alpha- tot de Epsilon proteobacteriën. Van eukaryote mitochondriën wordt gedacht dat ze afstammelingen zijn van alfaproteobacteriën, terwijl eukaryote chloroplasten zijn afgeleid van cyanobacteriën. Archaeale phyla worden beschreven in figuur 22.14.

Het plasmamembraan van prokaryoten

Het prokaryotische plasmamembraan is een dunne lipide dubbellaag (6 tot 8 nanometer) die de cel volledig omringt en de binnenkant van de buitenkant scheidt. Zijn selectief permeabele aard houdt ionen, eiwitten en andere moleculen in de cel en voorkomt dat ze diffunderen naar de extracellulaire omgeving, terwijl andere moleculen door het membraan kunnen bewegen. Bedenk dat de algemene structuur van een celmembraan een fosfolipide dubbellaag is die is samengesteld uit twee lagen lipidemoleculen. In archaeale celmembranen, isopreen (fytanyl) ketens gekoppeld aan glycerol vervangen de vetzuren gekoppeld aan glycerol in bacteriële membranen. Sommige archaeale membranen zijn monolagen van lipiden in plaats van dubbellagen (Figuur 22.15).

De celwand van prokaryoten

Het cytoplasma van prokaryotische cellen heeft een hoge concentratie opgeloste stoffen. Daarom is de osmotische druk in de cel relatief hoog. De celwand is een beschermende laag die sommige cellen omgeeft en ze vorm en stevigheid geeft. Het bevindt zich buiten het celmembraan en voorkomt osmotische lysis (barsten door toenemend volume). De chemische samenstelling van de celwand varieert tussen Archaea en Bacteria, en ook tussen bacteriesoorten.

Bacteriële celwanden bevatten peptidoglycaan, samengesteld uit polysacharideketens die verknoopt zijn door ongebruikelijke peptiden die zowel L- als D-aminozuren bevatten, waaronder D-glutaminezuur en D-alanine. (Eiwitten hebben normaal gesproken alleen L-aminozuren als gevolg, veel van onze antibiotica werken door D-aminozuren na te bootsen en hebben daarom specifieke effecten op de ontwikkeling van bacteriële celwanden.) Er zijn meer dan 100 verschillende vormen van peptidoglycaan. S-laag (oppervlaktelaag) eiwitten zijn ook aanwezig aan de buitenkant van celwanden van zowel Archaea als Bacteria.

Bacteriën zijn onderverdeeld in twee hoofdgroepen: Gram-positieve en Gram-negatief , op basis van hun reactie op Gram-kleuring. Merk op dat alle Gram-positieve bacteriën behoren tot één phylum-bacterie in de andere phyla (Proteobacteria, Chlamydias, Spirochetes, Cyanobacteria en anderen) zijn Gram-negatief. De Gram-kleuringsmethode is vernoemd naar de uitvinder, de Deense wetenschapper Hans Christian Gram (1853-1938). De verschillende bacteriële reacties op de kleuringsprocedure zijn uiteindelijk te wijten aan de celwandstructuur. Gram-positieve organismen missen meestal het buitenmembraan dat wordt aangetroffen in Gram-negatieve organismen (Figuur 22.16). Tot 90 procent van de celwand in Gram-positieve bacteriën bestaat uit peptidoglycaan, en het grootste deel van de rest bestaat uit zure stoffen die teichoïnezuren. Teichoïnezuren kunnen covalent worden gekoppeld aan lipiden in het plasmamembraan om te vormen lipoteichoïnezuren. Lipoteichoïnezuren verankeren de celwand aan het celmembraan. Gram-negatieve bacteriën hebben een relatief dunne celwand die bestaat uit een paar lagen peptidoglycaan (slechts 10 procent van de totale celwand), omgeven door een buitenste envelop die lipopolysacchariden (LPS) en lipoproteïnen bevat. Deze buitenste envelop wordt soms een tweede lipidedubbellaag genoemd. De chemie van deze buitenste envelop is echter heel anders dan die van de typische lipidedubbellaag die plasmamembranen vormt.

Visuele verbinding

Welke van de volgende uitspraken is waar?

  1. Gram-positieve bacteriën hebben een enkele celwand die door lipoteichoïnezuur aan het celmembraan is verankerd.
  2. Porines zorgen ervoor dat stoffen in zowel Gram-positieve als Gram-negatieve bacteriën kunnen binnendringen.
  3. De celwand van Gram-negatieve bacteriën is dik en de celwand van Gram-positieve bacteriën is dun.
  4. Gram-negatieve bacteriën hebben een celwand van peptidoglycaan, terwijl Gram-positieve bacteriën een celwand hebben van lipoteichoïnezuur.

Archaïsche celwanden hebben geen peptidoglycaan. Er zijn vier verschillende soorten archaïsche celwanden. Eén type is samengesteld uit pseudopeptidoglycaan, dat qua morfologie vergelijkbaar is met peptidoglycaan, maar verschillende suikers in de polysacharideketen bevat. De andere drie soorten celwanden zijn samengesteld uit polysachariden, glycoproteïnen of pure eiwitten. Andere verschillen tussen Bacteria en Archaea zijn te zien in Tabel 22.2. Merk op dat kenmerken die verband houden met DNA-replicatie, transcriptie en translatie in Archaea vergelijkbaar zijn met die in eukaryoten.

Structureel kenmerk: bacteriën Archaea
celtype prokaryotisch prokaryotisch
celmorfologie Variabele Variabele
celwand Bevat peptidoglycaan Bevat geen peptidoglycaan
Type celmembraan lipide dubbellaag Lipide dubbellaag of lipide monolaag
Plasmamembraanlipiden Vetzuren-glycerolester Fytanyl-glycerolethers
chromosoom typisch circulair typisch circulair
Oorsprong van replicatie Enkel Meerdere
RNA-polymerase Enkel Meerdere
Initiator tRNA Formyl-methionine methionine
Streptomycine remming Gevoelig Resistent
Calvin cyclus Ja Nee

Reproductie

Voortplanting in prokaryoten is aseksueel en vindt meestal plaats door binaire splitsing. (Onthoud dat het DNA van een prokaryoot een enkel, circulair chromosoom is.) Prokaryoten ondergaan in plaats daarvan geen mitose, het chromosoom wordt gerepliceerd en de twee resulterende kopieën scheiden van elkaar vanwege de groei van de cel. De prokaryoot, nu vergroot, wordt naar binnen geknepen bij de evenaar en de twee resulterende cellen, die klonen, verschillend. Binaire splitsing biedt geen mogelijkheid voor genetische recombinatie of genetische diversiteit, maar prokaryoten kunnen genen delen via drie andere mechanismen.

Bij transformatie neemt de prokaryoot DNA op dat door andere prokaryoten in zijn omgeving is afgestaan. Als een niet-pathogene bacterie DNA voor een toxinegen van een pathogeen opneemt en het nieuwe DNA in zijn eigen chromosoom opneemt, kan ook deze pathogeen worden. Bij transductie kunnen bacteriofagen, de virussen die bacteriën infecteren, korte stukjes chromosomaal DNA van de ene bacterie naar de andere verplaatsen. Transductie resulteert in a recombinant organisme. Archaea heeft ook virussen die genetisch materiaal van het ene individu naar het andere kunnen verplaatsen. Bij conjugatie wordt DNA overgedragen van de ene prokaryoot naar de andere door middel van a pilus, die de organismen met elkaar in contact brengt en een kanaal biedt voor de overdracht van DNA. Het overgebrachte DNA kan de vorm hebben van een plasmide of als een samengesteld molecuul, dat zowel plasmide als chromosomaal DNA bevat. Deze drie processen van DNA-uitwisseling worden getoond in figuur 22.17.

Voortplanting kan heel snel gaan: een paar minuten voor sommige soorten. Deze korte generatietijd in combinatie met mechanismen van genetische recombinatie en hoge mutatiesnelheden resulteert in de snelle evolutie van prokaryoten, waardoor ze zeer snel kunnen reageren op veranderingen in de omgeving (zoals de introductie van een antibioticum).

Evolutie verbinding

De evolutie van prokaryoten

Hoe beantwoorden wetenschappers vragen over de evolutie van prokaryoten? In tegenstelling tot dieren bieden artefacten in het fossielenbestand van prokaryoten heel weinig informatie. Fossielen van oude prokaryoten zien eruit als kleine belletjes in gesteente. Sommige wetenschappers wenden zich tot genetica en tot het principe van de moleculaire klok, die stelt dat hoe recenter twee soorten uit elkaar zijn gegaan, hoe meer hun genen (en dus eiwitten) op elkaar zullen lijken. Omgekeerd zullen soorten die lang geleden uit elkaar gingen meer genen hebben die niet op elkaar lijken.

Wetenschappers van het NASA Astrobiology Institute en het European Molecular Biology Laboratory hebben samengewerkt om de moleculaire evolutie te analyseren van 32 specifieke eiwitten die voorkomen bij 72 soorten prokaryoten. 2 Het model dat ze uit hun gegevens hebben afgeleid, geeft aan dat drie belangrijke groepen bacteriën: Actinobacteriën, deinokok, en cyanobacteriën (gezamenlijk genoemd Terrabacteriën door de auteurs) - waren de eersten die land koloniseerden. Actinobacteriën zijn een groep van veel voorkomende Gram-positieve bacteriën die vertakte structuren zoals schimmelmycelia produceren, en omvatten soorten die belangrijk zijn bij de afbraak van organisch afval. Dat zul je je herinneren deinokok is een geslacht van bacteriën die zeer resistent is tegen ioniserende straling. Het heeft een dikke peptidoglycaanlaag naast een tweede uitwendig membraan, dus het heeft kenmerken van zowel Gram-positieve als Gram-negatieve bacteriën.

Cyanobacteriën zijn fotosynthetiserende middelen en waren waarschijnlijk verantwoordelijk voor de productie van zuurstof op de oude aarde. De tijdlijnen van divergentie suggereren dat bacteriën (leden van het domein Bacteria) tussen 2,5 en 3,2 miljard jaar geleden afweken van gemeenschappelijke voorouderlijke soorten, terwijl de Archaea eerder divergeerde: tussen 3,1 en 4,1 miljard jaar geleden. Eukarya week later af van de archaïsche lijn. Het werk suggereert verder dat stromatolieten die werden gevormd vóór de komst van cyanobacteriën (ongeveer 2,6 miljard jaar geleden) fotosynthetiseerden in een anoxische omgeving en dat vanwege de modificaties van de Terrabacteria voor land (weerstand tegen uitdroging en het bezit van verbindingen die het organisme beschermen) van overtollig licht), kan fotosynthese met zuurstof nauw verband houden met aanpassingen om op het land te overleven.


Nadat het sigma is verwijderd, gaat RNA-polymerase door met het uitpakken van de matrijs en coderende strengen van het DNA, en worden R-nucleotiden gebonden via fosfodiesterbindingen met behulp van de code die wordt geleverd door de matrijsstreng van DNA. Het binnenkomende DNA komt binnen in een inlaatportaal en wordt opengeritst met een rits. Als het DNA de ritssluiting passeert, worden de waterstofbruggen weer vastgemaakt tussen de coderende streng en de matrijsstreng en vertrekt de dubbele DNA-helix door een uitgangsportaal. R-nucleotiden komen binnen via een ander inlaatportaal en worden gecombineerd via complementaire basenparing met de matrijsstreng van DNA. De R-nucleotiden zijn aan elkaar gebonden via fosfodiesterbindingen. R-nucleotiden worden continu toegevoegd aan het 3'-uiteinde van de zich ontwikkelende RNA-streng. Het 5'-uiteinde van de RNA-streng verlaat een ander uitgangsportaal van de RNA-polymerase.

Verlengingsfase van transcriptie


Materialen en methodes

Proteoomsequenties

Uit bijna 2.000 soorten met genomen genomen (ongeveer 150 eukaryoten uit de Genome OnLine Database [38]), selecteerden we 76 voor deze studie waarvan de mate van complexiteit wordt gerapporteerd in de literatuur [1-4]. Hiervan werden 23 bacteriën geselecteerd om het volledige scala aan gennummers te dekken, variërend van 450 tot 8.000. 53 eukaryoten werden geselecteerd zoals in [2], compleet met volledig gesequeneerde planten- en andere eukaryote soorten om te proberen het volledige scala van complexiteit te dekken, met gen nummers variërend van 3.800 tot 92.000. De soorten en hun aantal verschillende celtypes (dat wil zeggen complexiteit) worden vermeld in aanvullend bestand 3. Sequenties van prokaryoten zijn gedownload van de Expasy Proteomics Server [39]. De proteomen van eukaryoten werden gedownload van Ensembl [40] en het National Center for Biotechnology Information [41]. Als er meerdere splitsingsvarianten aanwezig waren, selecteerden we het langste transcript, behalve de alternatieve splitsingsstudies, waar we ze allemaal in overweging namen.

Voorspelling van structurele stoornis

Structurele wanorde van alle eiwitten in een proteoom werd voorspeld met het IUPred-algoritme [25], beschikbaar op [42]. Een residu werd geclassificeerd als lokaal ongeordend als zijn score boven de drempel van 0,5 lag, en wanorde van een eiwit werd genomen als het percentage van dergelijke residuen in het eiwit. De gemiddelde wanorde van hele proteomen werd berekend als het gemiddelde van het percentage ongeordende residuen van de eiwitten.

Analyse van stoornis van eiwitten met SCOP-domeinen

De volledige SCOP-domeindatabase werd gedownload van [43] (release 1.75 [44]), en domeinsequenties werden gedownload van de A STRAL-database [45, 46]. We selecteerden alle domeinen die behoren tot superfamilies waarvan de uitbreiding respectievelijk een goede (Pearson-correlatiecoëfficiënt R 0,8) of een slechte (R 0,2) correlatie met biologische complexiteit vertoonde, zoals gerapporteerd in [2]. Dit resulteerde in drie sets eiwitsequenties: expansie (met een SCOP-domein dat een goede correlatie vertoont, N = 19.326), niet-uitbreidbaar (met SCOP-domeinen die een slechte correlatie vertonen, N = 32.990) en alle (met elk type SCOP-domeinen, N = 110.800). We hebben een BlastP-zoekopdracht uitgevoerd met sequenties van SCOP-domeinen in de drie sets tegen bestudeerde prokaryotische en eukaryote proteomen. Vervolgens voorspelden we structurele stoornis van eiwitten met sequentie-identiteit met een SCOP-domein van meer dan 50%.

Eiwit-eiwit interacties in verschillende proteomen

We hebben gegevens over binaire PPI's geëxtraheerd in vier prokaryotische (Mycoplasma genitalium, Neisseria meningitidis, Escherichia coli, Streptomyces coelicolor) en 12 eukaryote proteomen (Dictyostelium discoideum, Schizosaccharomyces pombe, Saccharomyces cerevisiae, Arabidopsis thaliana, Caenorhabditis elegans, Drosophila melanogaster, Ciona intestinalis, Danio rerio, Xenopus tropicalis, Gallus gallus, Mus musculus en Homo sapiens) uit de STRING-database [47, 48].

Voorspelling van bindingsgebieden van eiwitten

Eiwitbindingsgebieden in ongeordende eiwitten/segmenten werden voorspeld door het ANCHOR-algoritme [20]. Een bindingsplaats werd voorspeld als er ten minste drie opeenvolgende aminozuren waren met een score boven 0,5. Twee aangrenzende bindingsplaatsen werden als onafhankelijk geaccepteerd als ze waren gescheiden door ten minste drie residuen met scores onder 0,5. Uit het patroon van eiwitbindingsgebieden werden verschillende maten berekend, zoals het gemiddelde percentage bindingsplaatsresiduen in het proteoom, het gemiddelde aantal bindingsplaatsen per eiwit en het totale aantal bindingsplaatsen in het gehele proteoom.

De complexiteit van menselijke weefsels bepalen

De complexiteit van menselijke weefsels werd bepaald door celtype-informatie voor elk weefsel te extraheren, samengesteld door BRENDA [37] voor de OBO Foundry [36], een gecoördineerde inspanning om open biologische en biomedische ontologieën te ontwikkelen.

Alternatieve splicing in verschillende soorten en menselijke weefsels

We hebben alternatieve splitsingsinformatie gehaald uit de ASAP II-database [9, 49], die alternatieve splitsingsgegevens voor 15 diersoorten bevat. Voor onze onderzoeken hebben we splicing-informatie gebruikt voor: Caenorhabditis elegans, Anopheles gambiae, Drosophila melanogaster, Danio rerio, Xenopus tropicalis, Gallus gallus, Bos Stier, Bruine rat, Mus musculus, en Homo sapiens. Voor elk proteoom werden verschillende maten berekend, zoals het percentage alternatief gesplitste multi-exon-genen en het gemiddelde aantal alternatieve splice-gebeurtenissen per eiwit. Voor menselijke weefsels hebben we ook de beschikbare alternatieve splicing-informatie geëxtraheerd uit de Swissprot-subset van Uniprot [50]. Bovendien hebben we informatie over weefselspecificiteit geëxtraheerd uit de commentaarregels van de annotatie die begint met "CC" in Uniprot, waar deze informatie ook beschikbaar was.

Statistische analyse en programmering

Voor het berekenen van standaarddeviatiewaarden van intrinsieke wanorde en eiwitbindende regio's, werd willekeurige bemonstering gebruikt. We selecteerden willekeurige subsets van 200 tot 500 leden, afhankelijk van de proteoomgrootte van de originele dataset, en berekenden de mediaan en/of het gemiddelde van de stoornis of het aantal bindingsregio's. We herhaalden de selectie 500 tot 1000 keer en de standaarddeviatie van het gemiddelde werd berekend. De significantie van verschillen tussen geselecteerde groepen werd beoordeeld met de niet-parametrische Mann-Whitney-test. Voor correlatieanalyse gebruikten we een niet-parametrische (Spearman) test en kozen voor tweezijdig P-waarden, behalve in figuur 1, waar we uitgingen van een Gauss-verdeling voor de proteoomgrootte en de Pearson-correlatiecoëfficiënten berekenden. Alle programma's zijn geschreven in Perl. De software IUPred [25] en ANCHOR [20] zijn verkregen van de auteurs en lokaal gecompileerd en uitgevoerd.


Homeobox-genen

Evolutie

Homeobox-genen worden gevonden in dieren, schimmels en planten, en meer recentelijk zijn ze ook gevonden in veel eencellige eukaryoten. Hoewel verschillende prokaryotische genomen nu zijn gesequenced, zijn er geen echte homeobox-genen in deze organismen gevonden. Het lijkt dus waarschijnlijk dat de eerste homeobox-genen ergens in de vroege eukaryote evolutie moeten zijn verschenen, waarschijnlijk afgeleid van een helix-turn-helix transcriptiefactor. In het voorouderlijke organisme waaruit uiteindelijk planten, schimmels en dieren zijn voortgekomen, moeten al minstens twee verschillende homeobox-genen hebben bestaan: een typisch homeobox-gen van 60 aminozuren en een TALE homeobox-gen. Dit voorouderlijke TALE-homeobox-gen had een geconserveerd stroomopwaarts domein waarvan de KNOX-, MEIS- en PBC-domeinen zijn afgeleid. In protisten en schimmels vinden we meestal slechts een kleine aanvulling van homeobox-genen (ongeveer 5-10), maar in meercellige organismen heeft een substantiële proliferatie van verschillende soorten homeobox-genen plaatsgevonden. Bijvoorbeeld in Arabidopsis thaliana, zijn er ongeveer 100 homeobox-genen die kunnen worden onderverdeeld in de hierboven beschreven klassen. Er is ook een grote uitbreiding opgetreden bij dieren, waar nu tientallen verschillende klassen en families van homeobox-genen zijn (zie paragraaf Klassen van Homeobox-genen). De opkomst van de verschillende klassen van homeobox-genen bij dieren lijkt te hebben plaatsgevonden in de vroege metazoa-evolutie, aangezien al in sponzen en cnidaria veel verschillende soorten homeobox-genen worden gevonden. De zeeanemoon Nematostella vectensis heeft ten minste 130 homeobox-genen, wat suggereert dat de cnidarian-bilaterian voorouder al ten minste 56 homeobox-genen had. In de modelsystemen van Drosophila melanogaster en C. elegans, vinden we ongeveer 100 homeobox-genen, terwijl er bij mensen, vanwege de extra duplicaties in de gewervelde lijn, ten minste 255 functionele genen en talrijke pseudogenen zijn.


Biologie 171

Aan het einde van dit gedeelte kunt u het volgende doen:

  • Beschrijf de verschillende stappen in de eiwitsynthese
  • Bespreek de rol van ribosomen bij eiwitsynthese

De synthese van eiwitten verbruikt meer energie van een cel dan enig ander stofwisselingsproces. Eiwitten zijn op hun beurt verantwoordelijk voor meer massa dan enig ander onderdeel van levende organismen (met uitzondering van water), en eiwitten vervullen vrijwel elke functie van een cel. Het proces van translatie, of eiwitsynthese, omvat het decoderen van een mRNA-bericht in een polypeptideproduct. Aminozuren worden covalent aan elkaar geregen door peptidebindingen met elkaar te verbinden in lengtes variërend van ongeveer 50 tot meer dan 1000 aminozuurresiduen. Elk afzonderlijk aminozuur heeft een aminogroep (NH2) en een carboxyl (COOH) groep. Polypeptiden worden gevormd wanneer de aminogroep van één aminozuur een amide (d.w.z. peptide) binding vormt met de carboxylgroep van een ander aminozuur ((Figuur)). Deze reactie wordt gekatalyseerd door ribosomen en genereert één watermolecuul.

De Eiwitsynthese Machines

Naast de mRNA-template dragen veel moleculen en macromoleculen bij aan het translatieproces. De samenstelling van elke component kan per soort verschillen, ribosomen kunnen bijvoorbeeld bestaan ​​uit verschillende aantallen rRNA's en polypeptiden, afhankelijk van het organisme. De algemene structuren en functies van de eiwitsynthesemachinerie zijn echter vergelijkbaar van bacteriën tot menselijke cellen. Translatie vereist de invoer van een mRNA-sjabloon, ribosomen, tRNA's en verschillende enzymatische factoren. (Opmerking: een ribosoom kan worden gezien als een enzym waarvan de aminozuurbindingsplaatsen worden gespecificeerd door mRNA.)

Klik door DNA Workshop: Eiwitsynthese (webpagina) om eiwitsynthese in actie te zien.

Ribosomen

Zelfs voordat een mRNA wordt vertaald, moet een cel energie investeren om elk van zijn ribosomen te bouwen. In E coli, zijn er op elk moment tussen de 10.000 en 70.000 ribosomen in elke cel aanwezig. Een ribosoom is een complex macromolecuul dat is samengesteld uit structurele en katalytische rRNA's en veel verschillende polypeptiden. Bij eukaryoten is de nucleolus volledig gespecialiseerd in de synthese en assemblage van rRNA's.

Ribosomen komen voor in het cytoplasma van prokaryoten en in het cytoplasma en ruw endoplasmatisch reticulum van eukaryoten. Mitochondria and chloroplasts also have their own ribosomes in the matrix and stroma, which look more similar to prokaryotic ribosomes (and have similar drug sensitivities) than the ribosomes just outside their outer membranes in the cytoplasm. Ribosomen dissociëren in grote en kleine subeenheden wanneer ze geen eiwitten synthetiseren en opnieuw associëren tijdens de initiatie van translatie. In E. coli, the small subunit is described as 30S, and the large subunit is 50S, for a total of 70S (recall that Svedberg units are not additive). Mammalian ribosomes have a small 40S subunit and a large 60S subunit, for a total of 80S. The small subunit is responsible for binding the mRNA template, whereas the large subunit sequentially binds tRNAs. Each mRNA molecule is simultaneously translated by many ribosomes, all synthesizing protein in the same direction: reading the mRNA from 5′ to 3′ and synthesizing the polypeptide from the N terminus to the C terminus. The complete mRNA/poly-ribosome structure is called a polysome .

TRNAs

The tRNAs are structural RNA molecules that were transcribed from genes by RNA polymerase III. Depending on the species, 40 to 60 types of tRNAs exist in the cytoplasm. Transfer RNAs serve as adaptor molecules. Each tRNA carries a specific amino acid and recognizes one or more of the mRNA codons that define the order of amino acids in a protein. Aminoacyl-tRNAs bind to the ribosome and add the corresponding amino acid to the polypeptide chain. Daarom zijn tRNA's de moleculen die de taal van RNA daadwerkelijk "vertalen" in de taal van eiwitten.

Of the 64 possible mRNA codons—or triplet combinations of A, U, G, and C—three specify the termination of protein synthesis and 61 specify the addition of amino acids to the polypeptide chain. Of these 61, one codon (AUG) also encodes the initiation of translation. Each tRNA anticodon can base pair with one or more of the mRNA codons for its amino acid. For instance, if the sequence CUA occurred on an mRNA template in the proper reading frame, it would bind a leucine tRNA expressing the complementary sequence, GAU. The ability of some tRNAs to match more than one codon is what gives the genetic code its blocky structure.

Als de adaptermoleculen van translatie is het verrassend dat tRNA's zoveel specificiteit in zo'n klein pakket kunnen passen. Consider that tRNAs need to interact with three factors: 1) they must be recognized by the correct aminoacyl synthetase (see below) 2) they must be recognized by ribosomes and 3) they must bind to the correct sequence in mRNA.

Aminoacyl tRNA Synthetases

The process of pre-tRNA synthesis by RNA polymerase III only creates the RNA portion of the adaptor molecule. The corresponding amino acid must be added later, once the tRNA is processed and exported to the cytoplasm. Through the process of tRNA “charging,” each tRNA molecule is linked to its correct amino acid by one of a group of enzymes called aminoacyl tRNA synthetases . At least one type of aminoacyl tRNA synthetase exists for each of the 20 amino acids the exact number of aminoacyl tRNA synthetases varies by species. These enzymes first bind and hydrolyze ATP to catalyze a high-energy bond between an amino acid and adenosine monophosphate (AMP) a pyrophosphate molecule is expelled in this reaction. The activated amino acid is then transferred to the tRNA, and AMP is released. The term “charging” is appropriate, since the high-energy bond that attaches an amino acid to its tRNA is later used to drive the formation of the peptide bond. Each tRNA is named for its amino acid.

Het mechanisme van eiwitsynthese

As with mRNA synthesis, protein synthesis can be divided into three phases: initiation, elongation, and termination. Het proces van translatie is vergelijkbaar in prokaryoten en eukaryoten. Here we’ll explore how translation occurs in E coli, een representatieve prokaryote, en specificeer eventuele verschillen tussen prokaryote en eukaryote translatie.

Initiatie van vertaling

Protein synthesis begins with the formation of an initiation complex . In E coli, this complex involves the small 30S ribosome, the mRNA template, three initiation factors (IFs IF-1, IF-2, and IF-3), and a special initiator tRNA , called tRNA Metf .

In E coli mRNA, een sequentie stroomopwaarts van het eerste AUG-codon, de Shine-Dalgarno-sequentie (AGGAGG) genoemd, interageert met de rRNA-moleculen die het ribosoom vormen. Deze interactie verankert de 30S-ribosomale subeenheid op de juiste locatie op de mRNA-sjabloon. Guanosine triphosphate (GTP), which is a purine nucleotide triphosphate, acts as an energy source during translation—both at the start of elongation and during the ribosome’s translocation. Binding of the mRNA to the 30S ribosome also requires IF-III.

The initiator tRNA then interacts with the start codon AUG (or rarely, GUG). This tRNA carries the amino acid methionine, which is formylated after its attachment to the tRNA. The formylation creates a “faux” peptide bond between the formyl carboxyl group and the amino group of the methionine. Binding of the fMet-tRNA Metf is mediated by the initiation factor IF-2. The fMet begins every polypeptide chain synthesized by E coli, but it is usually removed after translation is complete. When an in-frame AUG is encountered during translation elongation, a non-formylated methionine is inserted by a regular Met-tRNA Met . After the formation of the initiation complex, the 30S ribosomal subunit is joined by the 50S subunit to form the translation complex. In eukaryotes, a similar initiation complex forms, comprising mRNA, the 40S small ribosomal subunit, eukaryotic IFs, and nucleoside triphosphates (GTP and ATP). The methionine on the charged initiator tRNA, called Met-tRNAl, is not formylated. However, Met-tRNAl is distinct from other Met-tRNAs in that it can bind IFs.

Instead of depositing at the Shine-Dalgarno sequence, the eukaryotic initiation complex recognizes the 7-methylguanosine cap at the 5′ end of the mRNA. A cap-binding protein (CBP) and several other IFs assist the movement of the ribosome to the 5′ cap. Once at the cap, the initiation complex tracks along the mRNA in the 5′ to 3′ direction, searching for the AUG start codon. Many eukaryotic mRNAs are translated from the first AUG, but this is not always the case. According to Kozak’s rules , the nucleotides around the AUG indicate whether it is the correct start codon. Kozak’s rules state that the following consensus sequence must appear around the AUG of vertebrate genes: 5′-gccRccAUGG-3′. The R (for purine) indicates a site that can be either A or G, but cannot be C or U. Essentially, the closer the sequence is to this consensus, the higher the efficiency of translation.

Once the appropriate AUG is identified, the other proteins and CBP dissociate, and the 60S subunit binds to the complex of Met-tRNAl, mRNA, and the 40S subunit. This step completes the initiation of translation in eukaryotes.

Translation, Elongation, and Termination

In prokaryotes and eukaryotes, the basics of elongation are the same, so we will review elongation from the perspective of E coli. When the translation complex is formed, the tRNA binding region of the ribosome consists of three compartments. The A (aminoacyl) site binds incoming charged aminoacyl tRNAs. De P (peptidyl)-plaats bindt geladen tRNA's die aminozuren dragen die peptidebindingen hebben gevormd met de groeiende polypeptideketen, maar die nog niet zijn gedissocieerd van hun overeenkomstige tRNA. De E (exit)-plaats maakt gedissocieerde tRNA's vrij, zodat ze kunnen worden opgeladen met vrije aminozuren. The initiating methionyl-tRNA, however, occupies the P site at the beginning of the elongation phase of translation in both prokaryotes and eukaryotes.

During translation elongation, the mRNA template provides tRNA binding specificity. As the ribosome moves along the mRNA, each mRNA codon comes into register, and specific binding with the corresponding charged tRNA anticodon is ensured. If mRNA were not present in the elongation complex, the ribosome would bind tRNAs nonspecifically and randomly (?).

Elongation proceeds with charged tRNAs sequentially entering and leaving the ribosome as each new amino acid is added to the polypeptide chain. Movement of a tRNA from A to P to E site is induced by conformational changes that advance the ribosome by three bases in the 3′ direction. The energy for each step along the ribosome is donated by elongation factors that hydrolyze GTP. GTP energy is required both for the binding of a new aminoacyl-tRNA to the A site and for its translocation to the P site after formation of the peptide bond. Peptidebindingen vormen tussen de aminogroep van het aminozuur gehecht aan het tRNA van de A-plaats en de carboxylgroep van het aminozuur gehecht aan het tRNA van de P-plaats. The formation of each peptide bond is catalyzed by peptidyl transferase , an RNA-based enzyme that is integrated into the 50S ribosomal subunit. The energy for each peptide bond formation is derived from the high-energy bond linking each amino acid to its tRNA. After peptide bond formation, the A-site tRNA that now holds the growing peptide chain moves to the P site, and the P-site tRNA that is now empty moves to the E site and is expelled from the ribosome ((Figure)). Verbazingwekkend, de E coli translation apparatus takes only 0.05 seconds to add each amino acid, meaning that a 200-amino-acid protein can be translated in just 10 seconds.

Many antibiotics inhibit bacterial protein synthesis. For example, tetracycline blocks the A site on the bacterial ribosome, and chloramphenicol blocks peptidyl transfer. What specific effect would you expect each of these antibiotics to have on protein synthesis?

Tetracycline would directly affect:

Chloramphenicol would directly affect:

Termination of translation occurs when a nonsense codon (UAA, UAG, or UGA) is encountered. Upon aligning with the A site, these nonsense codons are recognized by protein release factors that resemble tRNAs. The releasing factors in both prokaryotes and eukaryotes instruct peptidyl transferase to add a water molecule to the carboxyl end of the P-site amino acid. This reaction forces the P-site amino acid to detach from its tRNA, and the newly made protein is released. The small and large ribosomal subunits dissociate from the mRNA and from each other they are recruited almost immediately into another translation initiation complex. Nadat veel ribosomen de translatie hebben voltooid, wordt het mRNA afgebroken, zodat de nucleotiden opnieuw kunnen worden gebruikt in een andere transcriptiereactie.

Protein Folding, Modification, and Targeting

During and after translation, individual amino acids may be chemically modified, signal sequences appended, and the new protein “folded” into a distinct three-dimensional structure as a result of intramolecular interactions. A signal sequence is a short sequence at the amino end of a protein that directs it to a specific cellular compartment. These sequences can be thought of as the protein’s “train ticket” to its ultimate destination, and are recognized by signal-recognition proteins that act as conductors. For instance, a specific signal sequence terminus will direct a protein to the mitochondria or chloroplasts (in plants). Once the protein reaches its cellular destination, the signal sequence is usually clipped off.

Many proteins fold spontaneously, but some proteins require helper molecules, called chaperones, to prevent them from aggregating during the complicated process of folding. Even if a protein is properly specified by its corresponding mRNA, it could take on a completely dysfunctional shape if abnormal temperature or pH conditions prevent it from folding correctly.

Sectie Samenvatting

The players in translation include the mRNA template, ribosomes, tRNAs, and various enzymatic factors. The small ribosomal subunit binds to the mRNA template either at the Shine-Dalgarno sequence (prokaryotes) or the 5′ cap (eukaryotes). Translation begins at the initiating AUG on the mRNA, specifying methionine. The formation of peptide bonds occurs between sequential amino acids matched to the mRNA template by their tRNAs according to the genetic code. Charged tRNAs enter the ribosomal A site, and their amino acid bonds with the amino acid at the P site. The entire mRNA is translated in three-nucleotide “steps” of the ribosome. When a nonsense codon is encountered, a release factor binds and dissociates the components and frees the new protein. Folding of the protein occurs during and after translation.

Art Connections

(Figure) Many antibiotics inhibit bacterial protein synthesis. For example, tetracycline blocks the A site on the bacterial ribosome, and chloramphenicol blocks peptidyl transfer. What specific effect would you expect each of these antibiotics to have on protein synthesis?

Tetracycline would directly affect:

Chloramphenicol would directly affect

(Figure) Tetracycline: a Chloramphenicol: c.

Free Response

Transcribe and translate the following DNA sequence (nontemplate strand): 5′-ATGGCCGGTTATTAAGCA-3′

The mRNA would be: 5′-AUGGCCGGUUAUUAAGCA-3′. The protein would be: MAGY. Even though there are six codons, the fifth codon corresponds to a stop, so the sixth codon would not be translated.

Explain how single nucleotide changes can have vastly different effects on protein function.

Nucleotide changes in the third position of codons may not change the amino acid and would have no effect on the protein. Other nucleotide changes that change important amino acids or create or delete start or stop codons would have severe effects on the amino acid sequence of the protein.

A normal mRNA that reads 5’ – UGCCAUGGUAAUAACACAUGAGGCCUGAAC– 3’ has an insertion mutation that changes the sequence to 5’ -UGCCAUGGuUAAUAACACAUGAGGCCUGAAC– 3’. Translate the original mRNA and the mutated mRNA, and explain how insertion mutations can have dramatic effects on proteins. (Hint: Be sure to find the initiation site.)

Original mRNA: 5’ –UGCC AUG GUA AUA ACA CAU GAG GCC UGA AC– 3’

Translation: Met – Val – Ile – Thr – His – Glu – Ala

Mutated mRNA: 5’ –UGCC AUG GuU AAU AAC ACA UGA GGCCUGAAC– 3’

Translation: Met – Val – Asn – Asn – Thr

Insertion mutations can have dramatic effects on proteins because they shift the reading frame for the codons. This changes the amino acids encoded by the mRNA, and can introduce premature start or stop sites.

Woordenlijst

aminoacyl tRNA synthetase enzyme that “charges” tRNA molecules by catalyzing a bond between the tRNA and a corresponding amino acid initiator tRNA in prokaryotes, called in eukaryotes, called tRNAl a tRNA that interacts with a start codon, binds directly to the ribosome P site, and links to a special methionine to begin a polypeptide chain Kozak’s rules determines the correct initiation AUG in a eukaryotic mRNA the following consensus sequence must appear around the AUG: 5’-GCC(purine)CCAUGG-3’ the bolded bases are most important peptidyl transferase RNA-based enzyme that is integrated into the 50S ribosomal subunit and catalyzes the formation of peptide bonds polysome mRNA molecule simultaneously being translated by many ribosomes all going in the same direction Shine-Dalgarno sequence (AGGAGG) initiates prokaryotic translation by interacting with rRNA molecules comprising the 30S ribosome signal sequence short tail of amino acids that directs a protein to a specific cellular compartment start codon AUG (or rarely, GUG) on an mRNA from which translation begins always specifies methionine

Difference between Enhancer and Promoter?

Definitie

An enhancer is a piece of DNA that enhances gene transcription. A promoter is a piece of DNA which acts to initiate or start gene transcription.

Binds with

An enhancer binds with transcription factors while a promoter binds with transcription factors and RNA polymerase enzyme.

Plaats

An enhancer can be upstream or downstream from the site where transcription is initiated while a promoter is always upstream from the site where transcription is initiated.

Afstand

An enhancer does not need to be close to the site where transcription is initiated while a promoter does have to be close to the site where transcription is initiated.

Function

An enhancer works to enhance or increase transcription while a promoter works to initiate the transcription process.

Importance

Enhancers are thought to be associated with diseases such as type 2 diabetes, cardiovascular disease, and colorectal cancer. Promoters are thought to be associated with diseases such as asthma and beta-thalassemia

Examples

Examples of enhancers include HACNS1 and PEE. Examples of promoters are the PEG-3 promoter and human telomerase reverse transcriptase (hTERT).


Bekijk de video: PROKARIOT VS EUKARIOT (Februari 2023).